Informace

Jaký je rozdíl mezi taxonomickými pomůckami Flora, Manual a Catalogue?

Jaký je rozdíl mezi taxonomickými pomůckami Flora, Manual a Catalogue?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Tři výše uvedené typy knih jsou taxonomickými pomůckami, které nabízejí informace o druzích vyskytujících se v dané oblasti. Přesný rozdíl mezi nimi mi však není jasný. Prosím vysvětlit.


A Flóra popisuje rostliny a kde žijí. Floras obvykle obsahuje dichotomický klíč pro účely identifikace a často také zahrnuje mapy rozsahu. Flory jsou téměř vždy navrženy tak, aby byly současně regionálně omezené a regionálně vyčerpávající/kompletní (tj. zahrnovaly všechny rostliny, které rostou v dané oblasti nebo alespoň všechny taxonomické divize specifikovaných taxonů). Viz Příklad.

A manuál se vztahuje mnohem šířeji na rostliny a obvykle vás poučí o tématu (např. identifikace/rozlišení druhů). Manuál nemusí být vyčerpávající a jeho rozsah je obvykle definován uživatelem (ačkoli často na základě rozsahu/rozsahu základního předmětu). Někteří však termín manuál použili jako víceméně synonymum pro Flora nebo jinak podobný dokument (např. viz zde).

A katalog je prostě seznam všech druhů organizovaných nějakým způsobem. Ty jsou obvykle abecední (vs. taxonomicky uspořádané jako typická flóra). V katalogu také nikdy nenajdete klíč a často najdete méně fytografických detailů.

Viz kapitola 6 v Popis druhů: Praktický taxonomický postup pro biology od Judith Winston pro další pomoc.


Enterobacter

Naši redaktoři zkontrolují, co jste odeslali, a rozhodnou, zda článek upravit.

Enterobacter, (rod Enterobacter), kterákoli ze skupiny tyčinkovitých bakterií z čeledi Enterobacteriaceae. Enterobacter jsou gramnegativní bakterie, které jsou klasifikovány jako fakultativní anaeroby, což znamená, že jsou schopny prosperovat v aerobním i anaerobním prostředí. Mnoho druhů má bičíky, a proto jsou pohyblivé. Vlastnosti, jako je motilita, stejně jako určité biochemické vlastnosti, včetně schopnosti syntetizovat enzym známý jako ornitindekarboxyláza, se používají k rozlišení Enterobacter z velmi podobného a úzce souvisejícího Klebsiella bakterie. Enterobacter je pojmenován podle převládajícího přirozeného prostředí organismů, střev zvířat (z řečtiny enteron, což znamená „střevo“).

Enterobacter jsou v přírodě všudypřítomné, jejich přítomnost ve střevním traktu zvířat má za následek jejich širokou distribuci v půdě, vodě a odpadních vodách. Nacházejí se také v rostlinách. U lidí mnohonásobné Enterobacter je známo, že druhy působí jako oportunní patogeny (organismy způsobující onemocnění), včetně E. cloacae, E. aerogenes, E. gergoviae, a E. aglomerans. Patogenní Enterobacter může způsobit jakýkoli z různých stavů, včetně očních a kožních infekcí, meningitidy, bakteriémie (bakteriální infekce krve), zápalu plic a infekcí močových cest. V mnoha případech onemocnění způsobené E. cloacae nebo podle E. aerogenes je spojena s expozicí organismům v nozokomiálních podmínkách, jako jsou nemocnice nebo pečovatelské domy.

Vznik lékové rezistence Enterobacter Organismy má komplikované léčebné režimy, zejména v nozokomiálních prostředích, kde se takové organismy stávají stále běžnějšími. Tradiční přístupy k léčbě Enterobacter infekce zahrnují jednočinnou antimikrobiální terapii, typicky aminoglykosidem, fluorochinolonem, cefalosporinem nebo imipenemem. V některých případech však subpopulace Enterobacter jsou schopny produkovat enzymy známé jako beta-laktamázy, které štěpí centrální kruhovou strukturu odpovědnou za aktivitu beta-laktamových antibiotik, což je skupina zahrnující imipenem (typ karbapenemu) a cefalosporiny. Opakovaná expozice těmto lékům vede k syntéze beta-laktamázy Enterobacter, což vede ke vzniku lékové rezistence, včetně proti karbapenemům, které byly kdysi vysoce účinné proti multirezistentním organismům. Novější přístupy k Enterobacter infekce přijaly režimy kombinované terapie využívající více antibiotik s různými základními strukturami, jako je aminoglykosid nebo fluorochinolon v kombinaci s beta-laktamovým činidlem. Navzdory příslibu této rozmanitější strategie však byla spojena s selekcí multirezistentních organismů.

Odolnost vůči Enterobacter k nebeta-laktamovým antibiotikům, včetně fluorochinolonů, jako je ciprofloxacin, zahrnuje odlišné buněčné a genetické mechanismy. Příklady bakterií využívajících takové mechanismy zahrnují rezistenci na ciprofloxacin E. aerogenes a multirezistentní E. aerogeneskterý je v mnoha případech rezistentní vůči ciprofloxacinu a imipenemu. v Enterobacter u organismů rezistentních na aminoglykosidy je rezistence spojena s bakteriálním genetickým prvkem známým jako integron. Integrony obsahují geny, které propůjčují schopnosti antibiotické rezistence a jsou začleněny do bakteriálních genomů prostřednictvím genetické rekombinace. Jsou účinně vyměňovány a rozšiřovány mezi cirkulujícími bakteriálními populacemi, jako jsou ty, které se vyskytují v nozokomiálních prostředích. v E. cloacae rezistence na aminoglykosid gentamicin byla přičítána přítomnosti integronů v genomu organismu.

Volný život Enterobacter jsou schopné fixace dusíku. Zejména určité druhy E. cloacae, se podílejí na symbiotické fixaci dusíku v rostlinách a byly izolovány z kořenových uzlů určitých plodin, jako je pšenice a čirok, a z rhizosfér rýže.


“Přírodní katakomby”

Zima při hledání vycpané veverky byla stejná zima, jakou jsem strávil pozorováním dravců, kteří se pomíjivě usadili kolem našeho domu. Mezi bezlistými stromy jsem zahlédl jestřáby a sokoly, jak se prořezávali lesem a spočinuli na větvích cukrových javorů, které označují hranici mezi naším dvorkem a lesem za ním. Nebylo nic neobvyklého vidět na holých větvích jestřába, jak občas mírně pohne hlavou, prohlíží oblohu a zem, jindy zůstává nehybný, mizí v krajině, než znovu exploduje k letu po bílé obloze.

Ale jakmile jsem byl uchvácen krásou ptáka, cítil jsem se nucen pokusit se ho identifikovat. Vybaveni dalekohledem a průvodcem jsme se s manželkou vydali zjistit: byl vodorovný pruh známkou Cooper's Hawk, nebo by to mohl být úplně jiný druh dravce? Naučil jsem se definovat ptáky pomocí těchto druhů jednoduchých a zdánlivě libovolných deskriptorů, čímž jsem každé zvíře redukoval na sadu zbarvení nebo geometrických tvarů: stěhovavého s jeho výraznými tmavými skvrnami pod očima, jestřába s ostrými lesky a pruhovaným čtvercovým ocasem. Jako by to bylo vše, co se dalo vědět, jako kdyby lokalizací nějakého definičního rysu, abstrahováním identity do několika rozlišovacích znaků, bylo možné pojmenovat stvoření, a tak nad ním mít nějaký druh ovládnutí.

Los Angeles County Museum of Natural History, 2012. [Wikimedia Commons]

Jak se rozhodneme, které aspekty zvířete jsou pro jeho taxonomii nejrelevantnější? V roce 1836 si bratr Henryho Davida Thoreaua John a sestra Sophia začali vést zápisník s katalogizací ptačích druhů, které viděli v lesích kolem Concordu ve státě Massachusetts, v krátké době začali hledat taxonomické kategorie, podle kterých by mohli rozlišovat ptáky ze Severní Ameriky. Ale jak píše Branka Arsić ve svém zkoumání ptáků a Thoreaua, „zápisník svědčí o Johnově rostoucí frustraci z vědeckých metod klasifikace“. 2 Jak listujete ve svazku, jeho rostoucí nelibost je hmatatelná. Nejprve se John pokusil uspořádat ptáky podle migračních vzorů a poté podle ročních období, ve kterých se pravděpodobně objeví, a poté podle přísného abecedního pořadí. Všechny tyto metody opustil, protože znovu a znovu došel k tvrdému závěru, že jakýkoli taxonomický systém škodí, když se na rozdíl od tvorů uspořádává dohromady kvůli nějakému domnělému řádu, a přitom popírá jiné afinity, které samy o sobě nemusí být vědecké, ale které však mohou mít ostřejší, objevnější významy.

Občas se John ve svém zápisníku zmiňoval o konkrétních ptácích — „17. května '37 Dospělý samec na ‚Chesuncook‘ ve společnosti samců z minulé sezóny, jejichž světlejší opeření příjemně kontrastovalo s brilantním šatem tohoto vyspělejšího exempláře“ — jako pokud chceme naznačit, do jaké míry taxonomie zdůrazněním zobecněných znaků nevyhnutelně selhává při zohlednění individuální rozmanitosti a odlišnosti. „To, co ho zajímá,“ uzavírá Arsić, „je to, co nemůže nabídnout žádná nomenklatura, jakkoli investovaná do nuancí: konkrétní a vztahové (jak konkrétní Oriole kontrastuje s ostatními ve sledované skupině), že.” 3

Impulsem Johna Thoreaua je nakonec nedůvěřovat přísnosti taxonomie, pozastavit se před procesem abstrahování živočišného druhu z jeho přirozeného prostředí a jeho umístění do vykonstruované hierarchie. Takové schematizace často vyžaduje figurální zabití, někdy dokonce doslovné. John James Audubon, velký ornitolog a ilustrátor, vzpomínal, jak jako malý chlapec zabil ledňáčka, aby ho mohl nakreslit, popsal, jak „probodl tělo rybářského ptáka a připevnil ho na prkno." "Konečně - přede mnou stál nemovitý Ledňáčka říčního,“ nepohyblivý předmět toho, co Audubon triumfálně nazval svou „první kresbou vlastně z přírody“. 4

Vzorky preparovaných ptáků v muzeu Mrs. M. A. Maxwell’s Rocky Mountain Museum, ca. 1875. [Boston Public Library]

Slavnější Thoreau, Henry, taxonomický imperativ zcela odmítl. „Nesnáším muzea, nic mě tak netíží,“ píše ve svém Časopis. „Jsou to katakomby přírody. … Jsou mrtvou přirozeností shromážděnou mrtvými muži. Nevím, jestli nejvíc dumám nad těly vycpanými bavlnou a pilinami, nebo nad těmi nacpanými střevy a masitým vláknem mimo pouzdra.“ 5 Thoreau viděl, že jakmile je exemplář přinesen do muzea, zatčen pro studium a katalogizován pro potomky, již ztratil svou podstatu. A ve skutečnosti, přes všechny své přínosy pro vědění, taxonomie vždy skrývala a dokonce tolerovala násilné činy, nadvládu. Jak vysvětluje vražedný soudce Holden, v Krvavý meridián"Cokoliv ve stvoření existuje bez mého vědomí, existuje bez mého souhlasu." V ponurém a násilném románu Cormaca McCarthyho soudce zachycuje a sbírá přírodní exempláře. "Tato anonymní stvoření... se mohou zdát málo nebo vůbec nic na světě," říká. "Přesto nás může sežrat sebemenší drobek." Jakákoli nejmenší věc pod ní je mimo lidské vědomí. Pouze příroda může zotročit člověka, a teprve když je existence každé poslední entity vyhnána a postavena před něj nahá, bude patřičným vládcem Země."

Naše posedlost taxonomií má již dlouho svou temnou stránku. Linnéova klasifikace byla použita k podpoře pseudovědeckých teorií rasové biologie 19. a počátku 20. století – k ospravedlnění již existujících názorů, že Afričané by se mohli odlišovat od Evropanů, že pokud změříte dostatek nosů, obočí a čelistí, mohl racionalizovat rasistickou politiku a koloniální honby. Éra, která viděla pokroky vědy, ve které se Carl Linné snažil porozumět přírodnímu světu jeho uspořádáním do království, kmenů a rodin, byla zároveň érou imperiálního dobývání, v níž byly miliony podrobeny, zotročeny a kolonizovány. . Z tohoto pohledu nelze práci žádného přírodovědce – ani expozici muzea – chápat jako skutečně nezaujatou.


Kapitola 1 Úvod

Elektronická biologická literatura

Obrovské rozšíření biologické literatury udělalo z počítače nepostradatelnou součást sady nástrojů každého biologa. Abstrakty a rejstříky jsou od počátku 70. let 20. století počítačově zpracovávány a původně je vyhledávali vyškolení zprostředkovatelé, jako jsou knihovníci a informační specialisté (další informace viz úvod ke kapitole 4). Počínaje polovinou 80. let byly tyto nástroje dostupné pro koncové uživatele a jejich dostupnost se od té doby pouze rozšířila. Další vlna informatizace zlepšila přístup k časopisům a elektronické knihy zaostávaly za svými periodickými sourozenci o několik desetiletí, ale začínají si přicházet na své.

Elektronické časopisy se dnes staly samozřejmostí teprve před 15 lety, byly novinkou a vyvolaly mnoho diskusí týkajících se užitečnosti, dostupnosti, nákladů, archivního úložiště, vlastnictví, práv k duševnímu vlastnictví, vzájemného hodnocení a dodržování autorských práv. Tyto kontroverzní otázky jsou stále aktuální, ale elektronický věk postupuje rychle. Všichni velcí komerční vydavatelé a společenští vydavatelé v současnosti zpřístupňují své časopisy elektronicky a několik iniciativ v biologických vědách pomohlo vydavatelům z menších společností přejít na plné texty. Stanford University Library nabízí elektronické publikování pomoci od roku 1995 prostřednictvím HighWire Press (http://www.highwire.org). V současné době poskytují přístup k více než 1500 časopisům vydávaným společnostmi a univerzitními tisky. Novější iniciativa organizace Scholarly Publishing and Academic Resources Coalition (SPARC), nazvaná BioOne (http://www.bioone.org), vytvořila jednotnou databázi obsahující články z časopisů vydávaných členskými společnostmi z Amerického institutu biologických věd. (AIBS). Byl spuštěn v dubnu 2001 za účasti asi 30 časopisů a nyní má více než 175 titulů ve 3 kolekcích.

Většina v současnosti dostupných elektronických časopisů jsou elektronické verze stávajících tištěných časopisů. V opojných počátcích elektronického publikování byla představena řada nových paradigmat, včetně zrušení nebo drastické úpravy současného systému vzájemného hodnocení. Předtiskové archivy, jako je fyzikální služba arXiv (http://arxiv.org/‎), byly považovány za způsob poskytování rychlého přístupu k výzkumu. Částečně kvůli dříve zmíněným obavám z vzájemného hodnocení začal počátek věku elektronických časopisů v biologických vědách mnohem klidněji než ve fyzice. Nejstarší elektronické časopisy v polovině až koncem 90. let byly jednoduše elektronické verze standardních tištěných časopisů, obvykle v předplatném s tištěnou i online verzí za jednu cenu. Byly zahájeny nové časopisy vydávané pouze v elektronické podobě, bez tištěného ekvivalentu, ale poté, co prošly obvyklým recenzním řízením, ale čelily mnoha překážkám. První dobře financovaný online časopis v oblasti biologických věd byl Online Journal of Current Clinical Trials (OJCCT), který byl založen v červenci 1992. Přes značné úsilí bylo zpočátku obtížné najít autory ochotné publikovat v časopise, a to i po roce 1994, kdy získal oficiální razítko schválení tím, že se stal prvním online časopisem indexovaným v roce Index Medicus. Přestal vycházet v roce 1996, ale byl to pouze první z mnoha online časopisů. Nyní v polovině roku 2010 mnoho standardních časopisů přestalo vycházet v tištěné podobě a jsou dostupné pouze online a mnoho nově vytvořených časopisů je dostupných pouze online.

Vydavatelé a knihovníci se intenzivně potýkali s otázkou, jak archivovat záložní soubory elektronických časopisů. Víme, jak uchovat kopie tištěných knih a časopisů: vydavatelé je tisknou na papír bez obsahu kyselin a knihovníci jejich kopie umísťují do klimaticky řízených zařízení na různých místech po celém světě. Zcela odlišná je situace v případě elektronických časopisů. Zpočátku si vydavatelé udržovali kontrolu nad elektronickými záložními soubory pro své časopisy, což způsobilo, že knihovníci a uživatelé měli obavy z toho, co se stane, když vedení souborů již nebude pro vydavatele ekonomicky výhodné, nebo pokud zaniknou. Vzhledem ke všem změnám v elektronických médiích (magnetické pásky na flash disky) a standardních softwarových programech (pamatujete WordPerfect?) existují obavy z migrace všech mas dat z jedné standardní platformy na druhou. Knihovníci a vydavatelé na tomto problému zapracovali, takže jsou zavedeny robustní a redundantní standardy a systémy, které by měly v budoucnu umožnit bezproblémové aktualizace a přenosy. Tyto systémy musí být ještě výrazně testovány v reálném životě, ale jejich existence je úleva pro všechny zúčastněné. Portico (http://www.portico.org/), LOCKSS (Lots Of Copies Keeps Stuff Safe, http://www.lockss.org/) a CLOCKSS (Controlled LOCKSS, http://www.clockss.org ) patří mezi nejdůležitější iniciativy.

Další série iniciativ, které způsobily revoluci v biologické literatuře, se zaměřuje na otevřený přístup (OA). Geneze hnutí OA sahá až do počátku internetového věku s jeho mantrou, že „informace chtějí být svobodné“. Krize cen předplatného v 80. a 90. letech navíc povzbudila autory a knihovníky, aby zkoumali alternativy k tradičním způsobům publikování. Konečný výsledek napětí mezi tradičním publikováním a OA je ještě třeba určit, ale mimo jiné vládní politiky, jako je politika veřejného přístupu NIH, o níž se diskutuje níže, zaručují, že pro OA bude v budoucnosti vědecké komunikace místo.

Existuje mnoho „příchutí“ otevřeného přístupu, ale základní definice poskytnutá advokátem Peterem Suberem (2013) je, že „literatura s otevřeným přístupem (OA) je digitální, online, bezplatná a bez většiny autorských a licenčních omezení. “ Mezi dva typy OA, které se vyskytují v biologických vědách, patří Author Pays (také známý jako „zlatý“ OA) a úložiště s otevřeným přístupem („zelený“ OA). Model Author Pays vzbudil většinu pozornosti, pozitivní i negativní. V tomto modelu platí autoři vědeckých publikací poplatek vydavateli časopisu za bezplatné zpřístupnění jejich článků ihned po zveřejnění. Některé časopisy jsou zcela OA, jako jsou časopisy PLoS, ale existuje mnoho dalších smíšených časopisů, ve kterých se někteří autoři rozhodnou platit za otevřený přístup a někteří ne.Tyto články OA dostávají stejnou recenzi jako jiné články a mnoho grantů poskytuje prostředky na publikace OA. Tento model je spíše podobný systému, který se vyskytuje v mnoha společenských publikacích, ve kterých se od autorů očekává, že budou platit poplatky za stránku. To pomáhá udržovat nízké ceny předplatného. Dva hlavní zdroje informací o OA jsou Directory of Open Access Journals (DOAJ), který obsahuje seznam časopisů OA (http://www.doaj.org/‎), a webová stránka SHERPA/Romeo (http://www.sherpa .ac.uk/romeo/), který uvádí zásady OA vydavatele.

Biologické a lékařské vědy byly v čele hnutí Open Access. Více než polovina významných časopisů uvedených v DOAJ jsou biomedicínské biomedicínské časopisy také publikují více článků než časopisy v jiných oborech a účtují vyšší autorské poplatky. Tři největší vydavatelé OA, PLoS, Biomed Central a Oxford University Press, všichni publikují v oblasti biomedicíny (Walters a Linville, 2011). Nedávno, v srpnu 2013, série zpráv zadaných pro Generální ředitelství Evropské komise pro výzkum a inovace ukázala, že 40 % článků publikovaných po celém světě v letech 2004–2011 bylo dostupných jako otevřený přístup (Archambault et al, 2013). Biologie dosáhla 57 % OA, zatímco 61 % článků biomedicínského výzkumu bylo dostupných jako OA. Zásady veřejného přístupu NIH a NSF diskutované níže měly také významný vliv na příčinu OA v biomedicínských oblastech.

Některé z prvních obav o model Author Pays se soustředily na možnost zneužití. Zatímco hlavní vydavatelé OA, jako je PLoS a BioMed Central, mají přísné procesy vzájemného hodnocení, které jsou stejné jako v nejlepších standardních časopisech, vždy panovali obavy, že bezohlední vydavatelé by tento model považovali za dojnou krávu, která by vydávala jakýkoli druh papíru jako dokud byli autoři ochotni vykašlat se na peníze. Zatímco naprostá většina vydavatelů OA se zaměřuje spíše na ideál bezplatného zpřístupňování informací a jejich vydělávání než na vydělávání peněz, byli identifikováni někteří bezohlední vydavatelé. Autoři, kteří hledají časopisy OA, ve kterých by mohli publikovat, by si měli položit mnoho stejných otázek, jaké by kladli na jakýkoli časopis. Kdo časopis vydává? Jsou autorské honoráře v souladu s ostatními OA časopisy ve vašem oboru? Slyšeli jste o tom vy nebo vaši mentoři někdy? Je časopis indexován v některém z hlavních indexů? Publikovali v něm autoři, které znáte a vážíte si jich, nebo jsou v redakční radě?

Model OA Repository nebo Green OA se liší od modelu Author Pays. V tomto modelu autoři po publikování v časopise zpřístupňují své články zdarma v nějakém úložišti, jako je osobní webová stránka autora nebo institucionální nebo disciplinární úložiště. V některých případech vydavatelé povolují, aby byly v úložišti k dispozici pouze zkopírované verze textového editoru konečného článku, nikoli PDF skutečného článku. Mnoho časopisů nyní sleduje tento zelený model tím, že veškerý obsah svých časopisů zpřístupňuje zdarma po období embarga, které je obvykle mezi 6 měsíci až rokem nebo i déle. Předpoklad v tomto modelu je, že většina použití článků přichází v poměrně krátké době po jejich zveřejnění, takže vydavatelé neriskují ztrátu předplatného tím, že zpřístupní starší obsah zdarma. Toto je model, který následují zásady NIH a NSF popsané níže.

Stejně jako jiné iniciativy, které se snaží změnit publikační model pro vědce, je OA od začátku kontroverzní. Historie PubMed Central to ilustruje. Původní návrh PubMed Central, poprvé zveřejněný v březnu 1999, se týkal jediné komplexní databáze obsahující všechny články z biomedicínského výzkumu z tradičních časopisů i preprinty, všechny dostupné zdarma. Obě části návrhu se ukázaly být kontroverzní, a když byl projekt PubMed Central spuštěn v únoru 2000, měl mnohem omezenější rozsah, než se původně plánovalo. Skládal se pouze z několika žurnálů a myšlenka předtiskového serveru byla zcela opuštěna. K únoru 2001 bylo na PubMed Central k dispozici pouze asi 10 časopisů, ale do roku 2013 bylo zahrnuto přes tisíc časopisů. Navzdory brzkým neúspěchům se příznivci OA prosadili a v dubnu 2008 byla implementována politika veřejného přístupu. Vyžadovalo, aby veškerý výzkum financovaný z grantů NIH byl veřejně dostupný do 12 měsíců od zveřejnění, a v únoru 2013 byla přijata podobná politika, která ovlivnila NSF a všechny ostatní federální agentury, které ročně vynakládají více než 100 milionů dolarů na podporu výzkumu. Autoři musí buď publikovat v časopisech podle zeleného systému OA, nebo uložit své články do PubMed Central nebo jiného úložiště. USA nejsou jedinou zemí, která má o OA úložiště zájem. Současně s návrhem PubMed Central byl implementován portál E-BioSci OA.

Jednou z potenciálních výhod modelu OA, který byl široce nabízený zastánci OA, je, že větší dostupnost bezplatných článků by vedla ke zvýšení viditelnosti a používání těchto článků. Výzkum studující citovanost článků OA a jiných článků byl smíšený, přičemž nejnovější studie prokázaly pouze mírný nárůst citovanosti článků s OA (Davis a Walters, 2011 Archambault et al, 2013). To zahrnuje srovnání článků OA a jiných článků v rámci stejných časopisů se smíšeným modelem (Davis, 2009).

Mimoevropské a malé evropské země rychle našly hodnotu v modelu OA jako mechanismu na podporu výzkumu prováděného v jejich vlastních zemích. Dobrým příkladem je brazilská SciELO (http://www.scielo.org), platforma, která publikuje více než 1 000 časopisů OA z několika zemí Jižní a Střední Ameriky. Waters a Linville (2011) zjistili, že 27 % časopisů OA, které studovali, publikovalo články v jiných jazycích než v angličtině a že procento časopisů OA vydávaných mimo Evropu a Severní Ameriku se zvýšilo z 10 % v roce 2005 na 31 % v roce 2009. I když to není úplně platné srovnání, porovnejte jej s 19 % neevropských a severoamerických časopisů indexovaných v Náhledy BIOSIS zmíněno výše.

Výzkumníci v biologických vědách vytvářejí obrovské množství dat, která musí být dostupná, aby byla užitečná. Data mohou zahrnovat ekologická data z dlouhodobých studií, držení muzejních sbírek, snímky z neurověd nebo molekulární nebo genetické sekvence. Dříve byla data publikována v článcích nebo knihách a jen zřídka aktualizována, ale s rozvojem elektronických časopisů a databází je tento materiál mnohem dostupnější a snadněji se s ním manipuluje. Molekulární biologie je dobrým příkladem disciplíny, která využívá elektronické publikování ke sdílení nových dat s multidisciplinární výzkumnou komunitou prostřednictvím elektronických produkcí, jako je GenBank, PDB (Protein Data Bank), Human Genome Project a tak dále. Co je na těchto databázích jedinečné, je to, že data jsou přijímána před publikováním v časopisecké literatuře a ve skutečnosti většina časopisů vyžaduje, aby byly sekvence přidány do GenBank před jejich publikací v tisku.

V důsledku dostupnosti všech těchto dat se techniky pro vyhledávání a propojování dat staly jednou z nejrychleji rostoucích oblastí biologie a informační vědy. Bioinformatika, využití výpočetní techniky a informační vědy k analýze biologických dat, se rozšířila. I když se tento termín často používá pouze pro analýzu informací o genomu nebo molekulární biologii, všechny oblasti biologie, které vytvářejí velké množství dat, mají své vlastní potřeby a odborníky na bioinformatiku. Hnutí Open Access umožnilo některé oblasti bioinformatiky, jako je dolování textu. Články, které jsou uzamčeny za paywallem, nejsou k dispozici pro dolování textu, ale abstrakty v PubMed a plný text z časopisů OA ano. Dalším krokem je zkombinovat odbornou literaturu s obrovskými databázemi molekulární biologie novými a zajímavými způsoby.

Všechny výše uvedené diskuse o elektronické biologické literatuře se soustředí na elektronické časopisy a databáze, které jsou měřítkem jejich důležitosti pro biologické vědy. Elektronické knihy přicházely pomaleji. Mezi nejstarší elektronické knihy patřily encyklopedie, slovníky a učebnice. I když některé implementace elektronických učebnic nebyly u studentů oblíbené, jejich příslib je zřejmý. V poslední době byly online úspěšné monografie, které napodobují časopisy v tom, že se skládají z jednotlivých kapitol fungujících jako samostatné články, nikoli jako soudržný celek, a většina vydavatelů vyrábí elektronické verze svých knih. Jednou komplikací je velký počet nekompatibilních čteček elektronických knih, i když jedním ze způsobů, jak tento problém obejít, je publikovat vědecké knihy jako soubory PDF jednotlivých kapitol. Knihovny si mohou předplatit jednotlivé tituly nebo velké či malé balíčky knih, podobně jako nechvalně známé Big Deals, které vydavatelé časopisů nabízejí.

Existuje relativně málo knih OA, ale knihy, které nejsou chráněny autorským právem, by mohly být považovány za ekvivalent e-knihy OA, i když tyto dva problémy spolu souvisejí pouze okrajově. V tomto bodě jsou podle amerického zákona o autorských právech všechny knihy vydané před rokem 1923 chráněny autorským právem (také známé jako volné dílo) a lze je použít a znovu publikovat podle potřeby. Knihy vydané v letech 1923 až 1989 mohou nebo nemusí být chráněny autorským právem a materiály vydané po roce 1989 jsou téměř jistě chráněny autorským právem. Zákony o autorských právech v jiných zemích se liší, takže problém je extrémně komplikovaný a může zpomalit vědecký pokrok. Pravděpodobně nejznámějším projektem digitalizace je projekt Google Books společnosti Google (http://books.google.com), jehož cílem je digitalizovat veškerou světovou literaturu, narazil na mnoho problémů souvisejících s autorským právem, ale knihy ve veřejném vlastnictví jsou mnohem dostupnější. Internetový archiv na http://archive.org (rovněž domov pro Wayback Machine, který archivuje webové stránky) je dalším projektem digitalizace, i když se zaměřuje na materiál ve veřejné doméně.

Ještě větší zájem biologů, zejména taxonomů, je Knihovna biodiverzity (BHL), která má za cíl digitalizovat veškerou literaturu o biodiverzitě na světě. Tento projekt začal v roce 2005 a byl vytvořen koalicí velkých botanických zahrad, přírodovědných muzeí a univerzit v USA a Velké Británii. Jedním z hlavních přínosů tohoto projektu je větší zpřístupnění historické taxonomické literatury (která může sahat až k Linnéovým publikacím) místním taxonomům, kteří nemají snadný přístup k hlavním americkým a evropským institucionálním knihovnám, které mohou uchovávat jediné kopie vzácná taxonomická díla. Záznamy BHL vstupují do Encyklopedie života, projekt zaměřený na vytvoření webové stránky pro každý z přibližně 1,8 milionu druhů organismů (viz kapitola 3).

I když nikdo nemůže číst budoucnost biologické literatury, lze s jistotou říci, že se bude i nadále rychle rozrůstat a že i když bude pokračovat vzájemné hodnocení, objeví se nové formáty spojující to nejlepší z tištěného světa a nového elektronického světa. Vydavatelé, autoři a knihovníci se budou i nadále potýkat s problémy souvisejícími s otevřeným přístupem a cenami časopisů.

Bibliografie

Archambault, Eric a kol. (2013). Podíl recenzovaných dokumentů s otevřeným přístupem na evropské a světové úrovni — 2004-2011. http://www.science-metrix.com/pdf/SM_EC_OA_Availability_2004-2011.pdf.

Davis, P. M. (2009). Publikování s otevřeným přístupem podle výběru autora v biologické a lékařské literatuře: Citační analýza. Journal of the American Society for Information Science and Technology 60(1):3-8.

Davis, P. M. a W. H. Walters. (2011). Vliv volného přístupu k vědecké literatuře: přehled nedávného výzkumu. Journal of the Medical Library Association 99(3): 208-217.

Walters, W. H. a A. C. Linvill. (2011). Charakteristika časopisů Open Access v šesti tematických oblastech. Vysokoškolské a výzkumné knihovny 72(4): 372-392.


Mikrobiální degradace forenzních vzorků biologického původu: potenciální hrozba pro typizaci lidské DNA

Forenzní biologie je dílčí disciplína biologické vědy s amalgámem dalších vědních oborů používaných v systému trestní justice. Jakákoli buňka/tkáň s jádrem obsahující DNA, ať už živá nebo mrtvá, může být použita jako forenzní exponát, zdroj vyšetřování pomocí typizace DNA. Tyto biologické materiály lidského původu jsou bohatým zdrojem bílkovin, sacharidů, lipidů, stopových prvků a také vody a poskytují tak ctnostné prostředí pro růst mikrobů. Neústupný mikrobiální růst zvyšuje proces degradace a je zesílen postupem času a nesprávným skladováním biologických materiálů. Degradace těchto biologických materiálů představuje obrovskou výzvu v následných procesech forenzní techniky typování DNA, jako je typizace DNA s krátkými tandemovými repeticemi (STR). Mikrobiální degradace vede k nesprávné nebo žádné PCR amplifikaci, heterozygotní nerovnováze píku, kontaminaci DNA z jiných než lidských zdrojů, degradaci DNA mikrobiálními vedlejšími produkty atd. V důsledku toho je nejpřesnější technika typizace STR DNA zrušena a lze jen stěží vyjádřit jednoznačný názor se znehodnocenými forenzními exponáty. Proto by měla být přijata vhodná preventivní opatření pro správné skladování a zpracování biologických exponátů, aby se minimalizoval proces jejich rozkladu mikroorganismy.

Toto je náhled obsahu předplatného, ​​přístup prostřednictvím vaší instituce.


Výsledek

Čtyři platné druhy rodu Adialytus, stejně jako dva další fenotypy: “Adialytus arvicola” (Starý) a “Adialytus srov. nejednoznačný” (Haliday) (tabulka 1) byly shromážděny a identifikovány ve spojení se 14 druhy mšic na 15 hostitelských rostlinách. Mnoho exemplářů Adialytus ambiguus (Haliday) se nejednotně lišily od zkoumaných exemplářů pocházejících z jiných zemí. Tyto exempláře jsme kategorizovali jako “Adialytus srov. nejednoznačný”. Adialytus veronicaecola (Starý) a “Adialytus arvicola”(Starý) jsou nově nahrány z Íránu. Poslední druh byl chován z Sipha mšice, které byly také konkrétními hostiteli Adialytus ambiguus. Našli jsme výrazné rozdíly mezi Adialytus ambiguus a “Adialytus arvicola” fenotyp, založený na znacích předního křídla, bičíkových segmentů, zadních končetin, řapíku (tabulka 2) a zbarvení. Navíc srovnání s typovými exempláři Adialytus arvicola z âeské republiky (Starý 1961a) jednoznaănű potvrdily existenci v˘razn˘ch rozdílŰ.

Stůl 1.

Seznam asociací mšice-parazitoid.

Rodina mšicDruhy mšicParazitoidní druhy
ChaitophorinaeSipha maydis Passerini Adialytus srov. nejednoznačný (Haliday)Adialytus arvicola (Starý)
Sipha elegans del Guercio Adialytus ambiguus (Haliday)Adialytus srov. nejednoznačný (Haliday)Adialytus arvicola (Starý)
Sipha flava (Forbes) Adialytus arvicola (Starý)
Chaitophorus spp. Adialytus salicaphis (Tchoř)
ThelaxinaeThelaxes suberi (del Guercio) Adialytus thelaxis (Starý)
AphidiinaeAphis craccivora Koch Adialytus veronicaecola (Starý)ϋr/>
Aphis gossypii Glover
Aphis sp.

Tabulka 2.

Morfometrická a meristická data pro různé znaky Adialytus druh (samice) v Íránu.

F1 † l/w F2 l/wF3 l/wF4 l/wF1/F2 délkaF1/F3 délkaF1/F4 délkaF1LP § F2LPč. bodu l/wR1 §§ /Pt délkaSetae na ClypeoviŘapík l/wPochva Ovipo-sitorl/w
Adialytus ambiguus2.10𠄲.302,40𠄲,601,90𠄲,101,80𠄲,001.00𠄱.100,90𠄱,000,90𠄱,0001𠄲2,90𠄳,001.30𠄱.404𠄵1,80𠄲,002,90𠄳,20
Adialytus srov. nejednoznačný2,60𠄲,852,70𠄲,902,70𠄲,851,80𠄲,000,90𠄱,000,90𠄱,100,90𠄱,100𠄱2𠄳2.85𠄳.100,90𠄱,104𠄵1,80𠄲,002,80𠄳,20
Adialytus arvicola2,50𠄲,802.10𠄲.452.20𠄲.401,70𠄱,900,90𠄱,100,90𠄱,100,95𠄱,200𠄱2𠄴3.00𠄳.200,70𠄰,806 𠄸2.00𠄲.202.80𠄳.10
Adialytus salicaphis2,70𠄲,902,60𠄲,902,50𠄲,802.30𠄲.501.00𠄱.200,90𠄱,101.00𠄱.203𠄵3𠄵3.25𠄳.350,90𠄱,008�2.20𠄲.402,40𠄲,50
Adialytus thelaxis1,60𠄱,701,50𠄱,601,50𠄱,601,60𠄱,701.00𠄱.201.00𠄱.200,90𠄱,103𠄵4𠄶2.80𠄳.100,90𠄱,008�1,80𠄲,002,60𠄲,70
Adialytus veronicaecola2.00𠄲.201,90𠄲,001,90𠄲,002.05𠄲.151.00𠄱.101.00𠄱.101.00𠄱.100𠄱0𠄱3.00𠄳.200,60𠄰,706 𠄸1,90𠄲,202.15𠄲.30

† : F1�: Bičíkovci 1𠄴 ‡ l/w: Poměr délka/šířka § LP: Podélné značky §§ R1: Radiální žíla 1 (= metakarpus) # : Pterostigma

Klíč k Adialytus druh v Íránu (na základě dospělých samic)

1Pochva vejcovodu značně prodloužená, poměr délka/šířka 2,80𠄳,20 (obr. 6A𠄼) 2
Silný plášť ovipositoru, poměr délka/šířka 2,20𠄲,70 (obr. 6D𠄿) 4
2Žíla R1 (= metakarpus) předního křídla 0,7𠄰,8 × dlouhá jako pterostigma (obr. 3C)Adialytus arvicola” (hvězdaý)
Žíla R1 předního křídla substejná (obr. 3B) nebo podstatně delší (obr. 3A) než pterostigma3
3Žíla R1 předního křídla 1.3𠄱.4 × dlouhá jako pterostigma, dosahující vrcholu křídla (obr. 3A)Adialytus ambiguus (Haliday)
Žíla R1 předního křídla 0,9𠄱,1 × dlouhá jako pterostigma, která nedosahuje vrcholu křídla (obr. 3B)Adialytus srov. ambiguus” (Haliday)
4Bičíkové segmenty (obr. 2E) jsou podkvadrát, o něco delší, než je jejich maximální šířka, l/w poměr 1,5𠄱,6. Bičíkové segmenty (obr. 2E) a zadní stehenní kost (obr. 4E) pokryté dlouhými a převážně vzpřímenými sety. Pochva ovipositoru ostře hranatá (obr. 6E) Adialytus thelaxis (Starý)
Bičíkové segmenty (obr. 2D, 2F) válcové, podstatně delší, než je jejich maximální šířka, l/w poměr 2,0𠄲,9.Bičíkové segmenty a zadní stehenní kost jsou pokryty přitisknutými (obr. 2F, 4F) nebo polovztyčenými (obr. 2D, 4D) setae. Pochva ovipositoru kulatě hranatá (obr. 6D, 6F) 5
5První metasomální tergit (řapík) protáhlý, 2,2𠄲,4 × tak dlouhý jako široký na úrovni spirakul (obr. 5D). Bičíkovité segmenty pokryté převážně polovztyčenými sety, které se rovnají průměru segmentu. Flagellomere 1 nesoucí 3𠄴 podélné plakety (obr. 2D). Zadní stehenní kost pokrytá převážně polovztyčenými sety (obr. 4D)Adialytus salicaphis (Tchoř)
První metasomální tergit (řapík) krátký, 1,9𠄲,1X tak dlouhý a široký u spirakul (obr. 5F). Bičíkovité segmenty pokryté přitisknutými sety, které jsou zřetelně kratší než průměr segmentu. Flagellomere 1 s 0𠄱 podélným štítkem (obr. 2F). Zadní stehenní kost pokrytá krátkými přitisknutými kosticemi (obr. 4F) Adialytus veronicaecola (Starý)

Seznam Adialytus druhů a jejich hostitelských sdružení

Adialytus nejednoznačný

Anténa z Adialytus druh A Adialytus ambiguus B Adialytus srov. nejednoznačný C Adialytus arvicola D Adialytus salicaphis E Adialytus thelaxis F Adialytus veronicaecola.

Přední křídlo Adialytus druh A Adialytus ambiguus B Adialytus srov. nejednoznačný C Adialytus arvicola D Adialytus salicaphis E Adialytus thelaxis F Adialytus veronicaecola.

Zadní noha Adialytus druhů, s výjimkou tarsomerů A Adialytus ambiguus B Adialytus srov. nejednoznačný C Adialytus arvicola D Adialytus salicaphis E Adialytus thelaxis F Adialytus veronicaecola.

Řapík nebo první metasomální tergit z Adialytus druh A Adialytus ambiguus B Adialytus srov. nejednoznačný C Adialytus arvicola D Adialytus salicaphis E Adialytus thelaxis F Adialytus veronicaecola.

Ženské genitálie Adialytus druh A Adialytus ambiguus B Adialytus srov. nejednoznačný C Adialytus arvicola D Adialytus salicaphis E Adialytus thelaxis F Adialytus veronicaecola.

Aphidius ambiguus Haliday, 1834: 104�.

Materiál prozkoumán.
Komentáře:

Tento druh je blízce příbuzný s jinými parazitoidy Sipha mšice, ve své prodloužené pochvě vejcovodu (obr. 6A) a trojúhelníkovém tvaru řapíku, který nese přední a spirakulární tuberkuly (obr. 5A). Lze jej odlišit od jiných druhů tím, že má extrémně dlouhou žílu R1 (= metakarpus) (obr. 3A). Zadní femur a holenní kost jsou pokryty jak krátkými, tak převážně vzpřímenými dlouhými štětinami (obr. 4A).

Adialytus nejednoznačný

Materiál prozkoumán.

22♂ 20♀,Sipha maydis Passerini dál Bromus tectorum, NK, Gharemeidan (37뀥'42"N, 56뀳'19"E, 1544 m), 14.V.2008, 15♂ 18♀, sb. S. Kazemzadeh Sipha elegansdel Guercio dál Gastridium phleoides, IS, Nazhvan (32뀸'25"N, 51뀵'48"E, 1582 m), 05.IX.2011, 7♂ 2‌♀, sb. E. Nader.

Komentáře.

Vzorky normálně běží do Adialytus ambiguus podle obecných znaků prvního metasomálního tergitu (obr. 5B), pochvy ovipositoru (obr. 6B), bičíků (obr. 2B) a setae na zadním femuru (obr. 4B). Lze to odlišit od Adialytus ambiguus tím, že má kratší žílu R1, která je 0,9𠄱,1 × tak dlouhou jako pterostigma, která nedosahuje vrcholu předního křídla (obr. 3B). Dá se oddělit od Adialytus arvicola (Obr. 3C), jeho delší žílou R1.

Adialytus arvicola

Materiál prozkoumán.

38♂ 63♀, Sipha flava(Forbes) na ‌Agropyrum repens, KE, Kermanshah (34뀙'33"N, 47뀅'53"E, 1322 m), 25.VI.2011, 22‌♂ 55‌♀, sb. Y. Nazari Sipha maydisPasserini dál Avena fatua, KE, Kermanshah (34뀙'33"N, 47뀅'53"E, 1322 m), 11.VI.2011, 2♂, sb. Y. Nazari dál Bromus tectorum, KE, Sanandaj (35뀗'52"N, 46끙'59"E, 1517 m), 16.V.2005, 1♂, sb. E. Rakhshani na Cynodon dactylon, KN, Kerman (30뀔'28"N, 57뀇'20"E, 1775 m), 22.XI.2007, 6♂ 2♀, sb. H. Barahoei na Sorghum halepense, KE, Kermanshah (34뀙'35"N, 47뀆'00"E, 1320 m), 11.VI.2011, 2‌♂ 3‌♀, kol.: Y. Nazari Sipha elegans del Guercio dál Triticum aestivum, KR, Mashhad (36뀕'22"N, 59뀨'42"E, 1164m), 12.IV.2012, 5♂ 3♀, sb. J. Karimi.

Komentáře.

Obecně lze tento druh zaměnit s jinými Adialytus druhy na Sipha mšice, ale je okamžitě rozeznatelný podle své velmi krátké žilky R1 (0,7𠄰,8 × dlouhé jako pterostigma) (obr. 3C). Také jeho řapík má mnohem silnější přední a spirakulární tuberkuly (obr. 5C). Většina metasomů je nažloutlá, zatímco v jiných Adialytus druh je jednotně hnědý až tmavě hnědý.

Adialytus salicaphis

Trioxys salicaphis Fitch, 1855: 841.

Materiál prozkoumán.

138♂ 223‌♀, Chaitophorus euphraticus Hodjat dál Populus euphratica, SB, Zahedan (29뀣'27"N, 60끈'49"E, 1498 m), 24.III.2003, 3♂ 7‌♀, sb. E. Rakhshani Chaitophorus remaudierei Pintera zapnutá Salix alba, KD, Marivan (35뀱'33"N, 46뀉'21"E, 1293 m), 08.X.2004, 4♂ 6‌♀, sb. E. Rakhshani Chaitophorus salijaponicus niger Mordvilko dál Salix alba, FA, Sepidan (30뀕'55"N, 51끘'43"E, 2244 m), 23.V.2009, 7♂ 9‌♀, sb. S. Taheri NK, Shirvan, 24.VI.2008, 32♂ 54♀, kol. S. Kazemzadeh NK, Esfarayen (37뀅'12"N, 57뀰'39"E, 1293 m), 17.V.2008, 8♂ 13♀, sb. S. Kazemzadeh Chaitophorus populialbae (Boyer de Fonscolombe) na Populus alba, AL, Karadj (35끄'45"N, 51뀐'07"E, 1296 m), 09.X.2002, 16♂ 29♀, sb. E. Rakhshani Chaitophorus populeti(Panzer) zapnuto Populus nigra, TH, Teherán (35끇'52"N, 51뀤'08"E, 1650 m), 09.XI.2002 32♂ 48♀ sb. E. Rakhshani Chaitophorus leucomelasKoch dál Populus nigra, KN, Lalezar (29뀱'05"N, 56끈'59"E, 2845 m), 09.X.2007, 5♂ 15♀, sb. H. Barahoei AL, Karadj (35끕'06"N, 51뀅'04"E, 1875 m) 27.VI.2003 11♂ 18♀, sb. E. Rakhshani na Populus sp. FA, Sepidan (30뀕'55"N, 51끘'43"E, 2244 m), 22.V.2009, 8♂ 12♀, kol.: S. Taheri Chaitophorus vitellinae(Schrank) na Salix alba, MA, Mahallat (33끓'12"N, 50뀧'31"E, 1652 m), 22.IV.2005, 5♂ 4♀, kol.: E. Rakhshani Chaitophorussp., na Populus alba, NK, Shirvan (37뀣'35"N, 57끔'40"E, 1082 m), 24.V.2008, 7♂ 8♀, sb. S. Kazemzadeh.

Komentáře.

Adialytus salicaphis se liší od ostatních kongenerů tím, že má velmi protáhlý první metasomální tergit (řapík) (obr. 5D) a krátké a husté okrajové sety předního křídla (obr. 3D). Lze to také odlišit od Adialytus arvicola počtem podélných značek na flagellomere 1 (3𠄵 in Adialytus salicaphis vs. 0𠄱 palců Adialytus arvicola). Vzorky Adialytus salicaphis spojený s Salix spp., zejména ty odchované z Chaitophorus salijaponicus niger na Salix alba, se mírně lišily od jedinců odchovaných Chaitophorus spp. na Populus. Hlavní rozdíly byly menší počet setae na clypeu (4𠄵 vs. 8�), menší podélné plakody na prvním flagellomere (1𠄲 vs. 3𠄵) a převážně setae na vlajce a krátkém zadní stehenní kost ve srovnání s dlouhými polovztyčenými až vzpřímenými sety mezi krátkými sety u vzorků z Populus.

Adialytus thelaxis

Materiál prozkoumán.

11♂ 26♀, Thelaxes suberi (del Guercio) na Quercus sp., GN, Rasht (37뀗'24"N, 49뀵'43"E, -4 m), 24.V.2004, 4♂ 3♀, kol.: E. Rakhshani dne Quercus castanifolia, GL, Gorgan (36끇'33"N, 54뀧'02"E, 340 m), 06.IV.2010, 7♂ 23♀, sb. A. Sargazi.

Komentáře.

Tento druh lze snadno oddělit od ostatních kongenerů tím, že má hlavně vztyčené dlouhé chochy na bičíkovce (obr. 2E) a zadní stehenní kosti (obr. 4E). Čepy na postero-dorzálním aspektu řapíku jsou podobné (obr. 5E). Dodatečně, Adialytus thelaxis je jediným druhem s ostře zahrocenou pochvou vejcovodů (obr. 6E).

Adialytus veronicaecola

Lysiphlebus veronicaecola Starý, 1978: 528�.

Materiál prozkoumán.

2♂ 3♀, Aphis craccivoraKoch dál Phaseolus vulgaris, IS, Flavarjan (32뀰'56"N, 51뀩'02"E, 1618 m), 2♀, sb. E. Nader Aphis sp. na Rubia tinctorum, IS, Mobarakeh (32뀰'56"N, 51뀰'17"E, 1658 m), 13.XI.2010, 1♂ 1♀, sb. E. Nader Aphis gossypiiRukavice na Cucurbita pepo,IS, Ghahderijan (32뀶'18"N, 51뀨'25"E, 1611 m), 05.XI.2010, 1♂, sb. E. Nader.

Komentáře.

Tento druh je výjimečný tím, že byl chován z Aphis druh. Podle obecných znaků předního křídla (obr. 3F), řapíku nebo prvního metasomálního tergitu (obr. 5F) a pochvy vejcovodu (obr. 6F) úzce souvisí s Adialytus salicaphis od kterého může být okamžitě odlišen tím, že má převážně krátké a přitisknuté setae na bičíku (obr. 2F) a zadní stehenní kosti (obr. 4F). Lze to také odlišit od Adialytus salicaphis tím, že má menší podélné plakety na flagellomerech 1 a 2 (0𠄱 in Adialytus veronicaecola vis 3𠄵 palců Adialytus salicaphis). Kromě toho Adialytus veronicaecola se liší od ostatních druhů tím, že má silnou pochvu ovipositoru se silně konvexním postero-dorzálním obrysem (obr. 6F).


Materiály a metody

Podrobnější popis lze nalézt v Doplňkových experimentálních postupech.

Zvířata

Samice myší divokého typu C57BL/6 byly chovány ve dvou různých prostředích (místnost 1 a místnost 2) ve stejné jednotce SPF krmené buď standardní stravou (potrava A: R34, Labfor, Lactamin, Stockholm, Švédsko) nebo autoklávovaná dieta (potravina B: 5021 Labdiet®, IPS, Londýn, Spojené království prostřednictvím Opend, Herfolge, Dánsko). Bezmikrobní myši byly kolonizovány cekální flórou od myší ve dvou místnostech a dále se s nimi zacházelo jako s konvenčními zvířaty53. Divoké volně žijící domácí myši (Mus musculus) byli chyceni živí v jihovýchodním Norsku pomocí pastí Ugglan (Grahnab, Gnosjö, Švédsko), schválených Norskou agenturou pro životní prostředí, a převezeni přímo na univerzitu v Göteborgu, schválené švédskou radou pro zemědělství. Všechny experimentální postupy na zvířatech byly provedeny v plném souladu se švédskou legislativou v oblasti dobrých životních podmínek zvířat a schváleny Švédským etickým výborem pro laboratorní zvířata v Göteborgu.

Odběr vzorků pro analýzu mikroflóry

Pomocí čistých sterilních disekčních nástrojů bylo odstraněno ileum (pouze Si8), distální tračník a slepé střevo. Obsah lumenu z Si8 a distálního tračníku byl odstraněn jemným vytlačením střevního obsahu v odběrové zkumavce. Střevní segment byl poté jemně propláchnut 2 x 1 ml sterilního PBS. Tkáň byla považována za vzorek hlenu. Vzorky byly okamžitě bleskově zmraženy v kapalném dusíku a později skladovány při -80 °C až do analýzy.

Extrakce DNA

DNA byla extrahována a homogenizována pomocí zařízení FastPrep®-24 Instrument (MP Biomedicals) a poté ošetřena lysozymem a vysrážena. Rozpuštěná DNA byla ošetřena RNázou A (Qiagen) a proteinázou K v pufru AL (Qiagen). DNA byla extrahována pomocí QIAamp DNA mini kit (Qiagen).

Pyrosekvenování a sekvenční analýza 16S rRNA genové značky

Bakteriální 16S rRNA genové sekvence byly amplifikovány z každého vzorku pomocí primerů 27F (5' AGAGTTTGATCCTGGCTCAG 3') s titanovým adaptérem B a 338R (5' TGCTGCCTCCCGTAGGAGT 3') s titanovým adaptérem s dvanácti nukleotidovými čárovými kódy a nukleotidovou sekvencí specifickou pro vzorek hypervariabilní oblast V1–V2 genu 16S rRNA pomocí FastStart Taq DNA polymerázy (Roche). Pro každý vzorek byly provedeny triplikáty PCR, které byly spojeny a purifikovány kuličkami AMPure (Becton Dickinson). Vzorky byly amplifikovány v emulzích PCR směs v oleji a sekvenovány z primeru 338r pomocí Roche 454 FLX a Titanium chemistry (Roche) v Science for Life Laboratories (Solna, Švédsko). Následné zpracování pyrosekvenačních dat bylo provedeno pomocí balíku QIIME software 1.7.054. Sekvence byly přiřazeny operačním taxonomickým jednotkám (OTU) pomocí UCLUST55. Hodnoty byly zarovnány s referenčním zarovnáním Greengenes Core pomocí PyNAST56. Taxonomie GG byly použity k vytvoření souhrnů taxonomických distribucí OTU na různých úrovních (kmen, řád, čeleď, rod a druh Fylogenetický strom byl vytvořen pomocí FastTree 57 a použit pro odhady α-diverzity (křivky Rarefaction, Chao1 58 , Shannonova diverzita 59 ) a β-diverzita (s použitím neváženého UniFrac 20 .

Měření hlenu

Tloušťka střevního hlenu byla měřena, jak bylo popsáno dříve2160. Penetrabilita hlenu byla měřena, jak bylo popsáno dříve1521.

Fixace tkání a imunobarvení

Kousky ilea nebo tlustého střeva s fekálním materiálem byly fixovány v Carnoy (methanol) a bakteriální FISH a imunobarvení bylo provedeno pomocí MUC2C3 antiséra 14, apoMuc2 antiséra 61 nebo protilátky Anti-Ki67 (ab16667, Abcam) a DNA od Hoechst 34580 (Life technologies) dříve popsané 14. Řezy byly analyzovány na délku krypt, počet buněk lamina propria, počet pohárkových buněk a počet Ki67-pozitivních buněk.

Proteomická analýza vzorků hlenu

Vzorky hlenu odebrané po měření tloušťky byly solubilizovány v pufru na bázi guanidinium hydrochloridu a zpracovány metodou FASP, jak bylo popsáno výše. Vzorky byly analyzovány nano-reverzní fázovou kapalinovou chromatografií (nRPLC) spojenou s elektrosprejovou ionizací – tandemovou hmotnostní spektrometrií (ESI-MS/MS) v LTQ-Orbitrap XL (Thermo Scientific)62. Data z MS/MS experimentů byla analyzována pomocí softwaru MaxQuant 1.2.2.563. Relativní množství proteinu byla kvantifikována v ppm absolutní kvantifikací na základě intenzity (iBAQ)64.

Statistická analýza

U veškerého hlenu byla data histologie a imunobarvení analyzována pomocí dvoustranného Mann–Whitneyho U-test. Pro analýzu mikroflóry byly provedeny významné rozdíly pomocí Wilcoxonova rank-sum testu a P-hodnoty byly převedeny na falešné hodnoty míry objevení (Q-values) pro opravu vícenásobného testování v softwaru R (http://www.r-project.org/).

Dostupnost dat

Data za grafy jsou uvedena ve zdrojovém datovém souboru na http://embor.embopress.org/. Sekvenační data Microbiota 16S rDNA byla uložena do archivu čtení sekvence ENA pod přístupovým číslem PRJEB7982 (http://www.ebi.ac.uk/ena/data/view). Proteomická data hmotnostní spektrometrie byla uložena do ProteomeXchange Consortium (http://proteomecentral.proteomexchange.org) prostřednictvím partnerského úložiště PRIDE 65 s identifikátorem datové sady PXD001479.


Revidovaná taxonomie (2001)

Skupina kognitivních psychologů, teoretiků kurikula a instruktážních výzkumníků a specialistů na testování a hodnocení zveřejnila v roce 2001 revizi Bloom’s Taxonomy s názvem Taxonomie pro výuku, učení a hodnocení. Tento název odvádí pozornost od poněkud statického pojetí “vzdělávacích cílů” (v původním názvu Bloom’) a poukazuje na dynamičtější pojetí klasifikace.

Autoři revidované taxonomie tuto dynamiku podtrhují tím, že k označení kategorií a podkategorií (spíše než podstatných jmen původní taxonomie) používají slovesa a gerundia. Tato “akční slova” popisují kognitivní procesy, kterými se myslitelé setkávají s poznatky a pracují s nimi:

  • Pamatovat si
    • Rozpoznávání
    • Odvolání
    • Tlumočení
    • Znázorňující
    • Klasifikace
    • Shrnutí
    • Odvozování
    • Porovnávání
    • Vysvětlování
    • Provádění
    • Implementace
    • Rozlišování
    • Organizování
    • Připisování
    • Kontrola
    • Kritizovat
    • Generování
    • Plánování
    • Výroba

    V revidované taxonomii jsou znalosti základem těchto šesti kognitivních procesů, ale její autoři vytvořili samostatnou taxonomii typů znalostí používaných v poznání:

    • Faktické znalosti
      • Znalost terminologie
      • Znalost konkrétních detailů a prvků
      • Znalost klasifikací a kategorií
      • Znalost principů a zobecnění
      • Znalost teorií, modelů a struktur
      • Znalost oborově specifických dovedností a algoritmů
      • Znalost oborově specifických technik a metod
      • Znalost kritérií pro určení, kdy použít vhodné postupy
      • Strategické znalosti
      • Znalosti o kognitivních úlohách, včetně vhodných kontextových a podmíněných znalostí
      • Sebepoznání

      Mary Forehand z University of Georgia poskytuje průvodce k revidované verzi, který poskytuje stručný souhrn revidované taxonomie a užitečnou tabulku šesti kognitivních procesů a čtyř typů znalostí.


      Popisy

      Podle profilů druhů Kew

      Cuscuta epithymum je bezkořenová, zcela parazitická rostlina, která se nejčastěji vyskytuje na vřesu (Calluna vulgaris), kustovnice (Ulex europaeus) a jetel (Trifolium) druhy. Dodder jetelový pochází z Evropy, ale vyskytuje se téměř po celém světě. Je členem čeledi Convolvulaceae, kam patří Ipomoea a Svlačec druhy, z nichž mnohé jsou běžně známé jako svlačec a svlačec. Dodder jetel je normálně opylován hmyzem, ale může se také samosprašovat. Studie ukázaly, že květiny navštěvuje mnoho různých druhů hmyzu, včetně mravenců, včel a vos.

      Profil druhu Geografie a rozšíření

      Přestože jetel jetelový pochází z Evropy, od té doby se rozšířil na šest kontinentů, díky čemuž se vyskytuje téměř po celém světě. Nicméně rod Cuscuta se nevyskytuje ve vysokých zeměpisných šířkách na severní polokouli nebo v pouštních oblastech Afriky a Asie. Malé, odlehlé ostrovy, jako jsou Galapágy, také postrádají druhy tohoto rodu. Zavlečení jetelovců do nepůvodních oblastí může následovat po neúmyslném dovozu semen C. epithymum u pícnin.

      Přehled: Jetel dodder je bezkořenová parazitická rostlina, jejíž listy jsou zmenšeny na drobné šupinky. Jeho stonky jsou bez chloupků, nitkovité (tloušťka 0,25-0,40 mm) a mohou mít žlutou, červenou nebo fialovou barvu.

      Květiny: Shluky 7-25 bezstopkavých, nafialovělých květů jsou uspořádány do kompaktní koule. Květy jsou 2,5-3,0 mm dlouhé a mají pět kališních lístků a okvětních lístků. Lístky se spojují do tvaru pohárku, přičemž každý jednotlivý lístek je delší než široký. Korunní trubice (trubková struktura vytvořená spojením všech okvětních lístků v květu) je delší než miskovité sepalové seskupení. Tyčinky (samčí části) vyčnívají z květů a mají oválně tvarované prašníky (pylonosné části). U květin se styl (samičí struktura) rozprostírá od vrcholu vaječníku a je obvykle stejně dlouhý jako vaječník.

      Ovoce: Plodem je kulovitá tobolka, která se po svém obvodu otevírá a je zakončena uschlými okvětními lístky. Každá tobolka obsahuje čtyři malá semena o průměru asi 1 mm.

      Existuje šest odrůd Cuscuta epithymum , které se vyznačují rozdíly ve struktuře květů a také v počtu květů a ve způsobu jejich seskupení.

      Invaze hostitelské rostliny

      Semena jetele dodder klíčí duben až červenec v reakci na sezónní změny teploty. Ze semene se vynoří oteklý, kořenový orgán, který však může přežít jen několik dní, a proto musí rychle najít hostitelskou rostlinu. Když je nalezen hostitel, jetelovi dodderovi vyroste přísavka, která se k němu přichytí. Kořenový orgán pak chřadne a jetelový plůdek pokračuje v růstu s využitím živin ukradených hostitelské rostlině prostřednictvím přísavky.

      Buňky přísavky produkují přilnavou látku, která funguje jako účinné lepidlo. V tkáni savce se vyvíjí intruzivní orgán (haustorium), který přímo proniká do hostitelské tkáně, aby vytvořil most mezi hostitelem a parazitem. Tento přímý kontakt umožňuje rychlý růst a je jedním z důvodů proč Cuscuta druhy jsou nejrychleji rostoucími parazitickými rostlinami.

      Stonky jetele dodder větrají proti směru hodinových ručiček kolem hostitelské rostliny, jak roste. Nová haustoria (orgány, které pronikají do hostitelské tkáně) se vyvíjejí těsně vedle sebe všude tam, kde stonka dodder vytváří těsné závity, když šplhá po hostitelské rostlině. Tyto těsné závity se střídají s volnějšími závity, které hledají nové hostitelské větve nebo nové hostitele k parazitování. Rozsah růstu závisí na kompatibilitě jetele s hostitelem a vitalitou hostitelské rostliny.

      Při pěstování na víceletých hostitelích, Cuscuta epithymum vyvolává tvorbu hálek (výrůstků hostitelské tkáně), kde je parazitická tkáň schopna přezimovat. Následující jaro se z těchto háčků vyvinou nové rostliny jetele.

      V severozápadní Evropě, Cuscuta epithymum kvete na vřesovištích, která jsou 0-3 roky stará. Rušení způsobené sekáním trávníku, vypalováním nebo sečením vřesovišť napomáhá klíčení semen jetele. Evropská suchá vřesoviště je obvykle obhospodařována na rotačním základě, čímž je zachována vysoká úroveň biologické rozmanitosti. Semena jetele mohou ležet ladem, což prodlužuje klíčivost na několik let, což je klíčové pro perzistenci tohoto druhu. Tímto způsobem může v půdě vybudovat „banku semen“, aby se vyrovnala s dynamickou povahou obhospodařovaných vřesovišť. Pokud však vřesoviště zůstane po dlouhou dobu neobhospodařované nebo pokud jsou semenné banky příliš malé nebo dostatečně dlouho životaschopné pro úspěšné obnovení, může dojít k místnímu vyhynutí jetelovců.

      Jetel jetelový se v tradiční medicíně používá jako projímadlo a k léčbě onemocnění jater, sleziny a močových cest. Skutečná účinnost jeho použití však byla jen málo vědecky zkoumána.

      Millennium Seed Bank: Skladování semen

      Partnerství Millennium Seed Bank Partnership si klade za cíl zachraňovat život rostlin po celém světě a zaměřuje se na rostliny v ohrožení a ty, které budou v budoucnu nejvíce využívány. Semena se suší, balí a skladují při teplotě pod nulou v našem trezoru banky semen.

      Dvě kolekce Cuscuta epithymum semena se uchovávají v Kew's Millennium Seed Bank se sídlem ve Wakehurstu v západním Sussexu.

      Viz Kew's Seed Information Database pro další informace o C. epithymum semena

      Jetel dodder není v současné době zaznamenán v Kew, ale příbuzný druh Cuscuta europaea (větší dodder) lze vidět rostoucí na Scutellaria altissima (vysoká čepice) v záhonech Plant Family v Kew.

      Sušené a alkoholem konzervované exempláře C. epithymum se konají v herbáři v Kew, kde jsou badatelům po domluvě k dispozici. Podrobnosti o některých z těchto exemplářů, včetně obrázků, lze vidět online v Kew's Herbarium Catalogue.

      Vzorky květů a semen C. epithymum , stejně jako exempláře rostoucí na vřesu, jsou uloženy ve sbírce ekonomické botaniky Kew v budově Sir Joseph Banks Building, kde jsou badatelům po domluvě k dispozici.

      Projekt virtuálního herbáře ve Velké Británii

      Cuscuta epithymum je jedním z 50 druhů na seznamu ohrožených rostlin Botanical Society of the British Isles (BSBI). Herbářové vzorky těchto druhů jsou digitalizovány v rámci britského projektu virtuálních herbářů.

      Zjistěte, jak můžete v tomto projektu pomoci, na webové stránce [email protected]

      Ekologie Běžný v narušených oblastech, zejména na narušených vřesovištích i v travnatých porostech. Conservation Vulnerable (VU) ve Velké Británii podle kritérií Červeného seznamu IUCN, ale celosvětově běžné. Rizika


      Biologie amarantů.

      Amaranthus je kosmopolitní rod jednoletých nebo krátkověkých vytrvalých rostlin (Dorling, 2008), včetně domestikovaných a ohrožených druhů, omezených endemitů a rozšířených plevelů (Sauer, 1950), které jsou běžně označovány jako „Amaranty“ nebo „Pigweeds“ (Bensch a kol., 2003). Jméno rodu Amaranthus pochází z řeckého slova „amarantos“ ([fráze vynechána]), které znamená „nevadnoucí“, „nesmrtelný“, „věčný“ nebo „nevadnoucí“, vzhledem k tomu, že jeho květy vydrží po dlouhá doba.

      Bylo hlášeno, že rod Amaranthus se skládá z 87 druhů, z nichž 14 je rozšířeno v Austrálii, 17 v Evropě a 56 v Americe (Jacobsen et al, 2000). Vzhledem k menšímu počtu studií o systematice amaranthu je však počet druhů stále orientační. Existuje určitá neshoda ohledně počtu druhů v tomto rodu s různými zprávami, jako je 60 druhů (Uphof, 1968 Singh et al., 1983 National Research Council, 1984 Budin et al., 1996 Wiersema & Leon, 1999), 70 druhů (Pratt et al., 1999 Costea & DeMason, 2001 Mosyakin & Robertson, 2003), přes 75 druhů (Sauer, 1993), 86 druhů (USDA, ARS, 1999) a 100 druhů (Hanf, 1984) [Tabulka], Příloha

      V současné době je Amaranthus rozšířen v mnoha částech světa, včetně Střední a Jižní Ameriky, Afriky, Číny, Indie a Spojených států (Budin et al, 1996). V asijské oblasti bylo hlášeno přibližně 25 druhů Amaranthus (Das, 2016). V Indii se druhy rodu Amaranthus vyskytují hlavně v Himalájích – od Kašmíru po Bhútán – a v jihoindických kopcích.

      Rod Amaranthus se vyznačuje následujícími znaky: Jednoletá nebo (vzácně) krátkodobá víceletá životní historie, bylinný habitus s prorostlým až vzpřímeným stonkem. Listy jsou střídavé, vejčité až čárkovité a mají vroubkovaný nebo vroubkovaný vrchol a hladké okraje. Květy jsou nedokonalé, u složených dicházií baleny do květenství. Rostliny Amaranthus jsou jednodomé (A. albus, A. blitum, A. caudatus, A. hybridus, A. powellii, A. retroflexus a A. spinosus) nebo dvoudomé (A. tuberculatus, A. palmeri a A. rudis) . Květenství je koncové a/nebo axilární se třemi až pěti okvětními lístky a tyčinkami. Jednodomé druhy jsou obecně samosprašné, opylované větrem. Plodem je utricule nebo pyxidium. Semena jsou čočkovitá a drobná (průměr 0,9 až 1,7 mm a hmotnost 1000 semen od 0,6 do 1 g), která jsou typicky rozptýlena větrem, vodou nebo ptáky, mají prodlouženou dobu klíčení s plodnou produkcí semen a základním počtem chromozomů 16. nebo 17 (Stevens, 1932 Sauer, 1967 Kigel, 1994 Pratt a kol., 1999 Franssen a kol., 2001b Costea & Tardif, 2003 Mosyakin & Robertson, 2003 Costea a kol., 2004). Kromě toho má tento rod [C.sub.4] fotosyntézu, na rozdíl od svých nejbližších příbuzných rodů (Weaver, 1984 Mitich, 1997 Bensch et al., 2003 Sage et al, 2007). Morfologická terminologie v Amaranthus, jak se používá v různých floristických a taxonomických ošetřeních, je poněkud matoucí, zejména pokud jde o ternis aplikovaný na květy a květenství. U každého druhu Amaranthus existuje několik ras definovaných jejich společným vzorem větvení, výškou, velikostí a formou květenství, dny do zralosti, velikostí semen a barvou a dalšími morfologickými charakteristikami (Espitia-Rangel, 1994 Brenner et al, 2000).

      Rod Amaranthus je často obtížné taxonomicky charakterizovat kvůli malým rozlišovacím znakům mezi jeho druhy, malým a obtížně viditelným diagnostickým částem, široké geografické distribuci, velkému počtu hybridních forem, což komplikuje taxonomii, a proto byl systematiky obecně považován za "obtížný" rod (Costea & DeMason, 2001). Rod Amaranthus byl poprvé popsán Linné (1753). Různé druhy tohoto rodu byly najednou rozpoznány jako samostatné rody, zejména dvoudomé druhy a jednodomé druhy s opadanými nebo neoplodněnými plody (Linnaeus, 1753 Kunth, 1838). Tyto rody byly později umístěny do Amaranthus Sauerem (1955) a Robertsonem (1981) a v současnosti jsou uznávány jako podrody. V nejnovější taxonomické práci byl rod rozdělen do tří podrodů: Acnida, Amaranthus a Albersia (Mosyakin & Robertson, 1996 Costea et al., 2001). Podrod Acnida je obecně vymezen tak, aby zahrnoval všechny dvoudomé druhy Amaranthus, zatímco podrod Amaranthus a podrod Albersia rozdělují jednodomé druhy pomocí kombinace polohy květenství, počtu okvětních lístků a rozevření plodů (Mosyakin & Robertson, 1996). Několik autorů mělo podezření, že tato infragenerická taxonomie nemusí dobře odpovídat evoluční historii (Eliasson, 1988 Mosyakin & Robertson, 2003), ale navzdory jejímu širokému geografickému rozšíření a úzkému spojení s lidskými aktivitami v současné době neexistuje žádná dobře vzorkovaná a dobře podložená fylogenetické studium tohoto rodu. Miiller a Borsch (2005) a Sage et al., (2007) zařadili Amaranthus do řádu Caryophyllales, čeleď Amaranthaceae, podčeleď Amaranthoideae, kmen Amarantheae, podkmen Amaranthinae, rod Amaranthus a podle Amaranthus) do sekce 1967 Sauer (1967)

      Předpokládá se, že centrem původu Amaranthus je Střední Amerika, s důkazy o jeho pěstování až 6700 let před naším letopočtem (Myers & Putnam, 1988 Putnam et al., 1989 Sauer, 1993 Kigel, 1994 Mposi, 1999). Aztécká civilizace středního Mexika představuje první zaznamenaný případ použití Amaranthu a tato plodina figurovala prominentně v aztécké kultuře během let 1400 až 1500 našeho letopočtu. Amaranthus, který Aztékové nazývali „huautli“, byl jejich základní potravou a byl začleněn do jejich náboženských obřadů. Jeho semena byla rozemleta aztéckými ženami a smíchána s medem, jinými sladkostmi a někdy s lidskou krví (National Research Council, 1984), poté formována do různých forem (včetně zvířat, přírodních prvků a bohů) pro konzumaci při náboženských obřadech a dalších příležitostech (Brenner a kol., 2000). Navzdory známému aztéckému zvyku lidských obětí je spojení lidské krve s postavami nejasné (National Research Council 1984).

      Po příchodu španělských dobyvatelů do Mexika na počátku roku 1500 našeho letopočtu se Španělé pokusili potlačit aztéckou kulturu a náboženství, takže po dobytí Amaranthus, jako plodina v Americe téměř zmizel (Sauer, 1950). Nicméně, podle španělských misionářů, používání Amaranthus jako jídla a v tradičních kulturních praktikách pokračovalo na omezené úrovni až do nějakých 50 let po španělském dobytí, ale následně klesalo (Early, 1992). I dnes se Amaranthus v této oblasti pěstuje v omezeném množství, z nichž většina se vymačkává a míchá s medem, aby se vyrobila cukrovinka zvaná „alegria“, což znamená „štěstí“.

      Sauer (1967) uvádí zavlečení Amaranthus do Španělska v šestnáctém století, odkud se rozšířil po celé Evropě. Kolem roku 1700 n. l. byla známá jako menší obilná rostlina ve střední Evropě a Rusku a na počátku devatenáctého století se dostala do Afriky a Asie. Až do poloviny 90. let byla jižní Asie jediným regionem na světě, kde produkce Amaranthus rostla (Brenner et al., 2000). Bylo to v 70. letech 20. století, kdy výzkum této rostliny začal v USA, teprve poté, co nové důkazy odhalily vysokou kvalitu obilného amarantového proteinu (Senft, 1980 Lehmann, 1996). Dnes se rozšířil po celém světě v různých oblastech Evropy, Asie a Afriky (Myers & Putnam, 1988 Putnam et al., 1989 Mposi, 1999). Amaranthus je tedy historická i současná rostlina.

      Amaranthus má vysokou genetickou variabilitu s rozmanitostí rostlinné formy (vzpřímené až posazené), výšky rostlin, počtu květenství (jedno až několik), barvy semen, obsahu bílkovin, výnosu semen, odolnosti vůči škůdcům a chorobám a přizpůsobení se typu půdy, pH, klima, srážky a délka dne (Kulakov, 1990). Ačkoli Amaranthus může růst na široké škále typů půd a úrovní půdní vlhkosti, bylo hlášeno, že dobře roste v hlinitých nebo písčito-hlinitých nebo hlinito-hlinitých půdách s dobrou schopností zadržovat vodu (Whitehead & Singh, 1993 Ghorbani et al., 1999 Palada & Chang, 2003) s rozsahem pH mezi 4,5 a 8,0 (National Research Council, 1984 Stallknecht & Schulz-Schaeffer, 1993 Palada & Chang. 2003).

      Amaranthus je extrémně přizpůsobivý nepříznivým podmínkám růstu a snáší sucho a nízkou plodnost (O'Brien & Price, 1983). Terénní studie ukázaly, že dobře roste na půdách s velmi proměnlivými úrovněmi půdních živin (National Research Council, 1984 Myers, 1998) a dobře reaguje na dobrou úrodnost půdy a organickou hmotu (Schippers, 2000). Zemědělská pole jsou skvělým stanovištěm pro jednoleté rostliny, jako je Amaranthus, které přirozeně rostou v otevřených nebo narušených oblastech a dostávají plné sluneční světlo (Pratt et al, 1999). Dieleman et al, (2000) poukázali na to, že rozšíření druhů Amaranthus na zemědělských polích je spojeno s vysokými hladinami dusičnanů a nízkými hladinami fosfátů a draslíku.

      Fenologie je studium periodických biologických dějů, které probíhají na různých úrovních, například v orgánech, tkáni nebo buňkách (Aim et al., 1991). Analýza fenologických stádií umožňuje přesně odhadnout konkurenci mezi plodinami a plevelem (Ghersa & Holt, 1995). Fenologické průzkumy mají tedy velký význam ve vědě o plevelech (Brainard et al., 2005) a mohou nám pomoci při vývoji realistického a praktického modelu pro kontrolu plevele (Elmore, 1996 Swanton et al., 1999).

      Fenologie různých druhů Amaranthus byla hlášena několika pracovníky. Forcella a kol. (1997) uvádí, že výskyt druhů Amaranthus začíná začátkem dubna a pokračuje až do konce května. Vzcházení A. tuberculatus začíná koncem května a pokračuje do začátku srpna (Hartzler et al., 1999), zatímco kvetení a nasazování semen pokračují až do prvního mrazu. Klíčení A. albus a A. blitoides nastává od poloviny května do začátku června. První semena A. blitum klíčí koncem června nebo začátkem července. Kvetení A. albus a A. blitoides začíná koncem června nebo začátkem července a A. blitum koncem července nebo začátkem srpna a pokračuje až do stárnutí vyvolané prvním podzimním mrazem (Stevens, 1924). Vypadávání semen (A. albus a A. blitoides) a plodů obklopujících semena (A. blitum) se prodlužuje po zbytek vegetačního období v důsledku neurčitého vzoru růstu květenství a neustálé tvorby nových květů (Costea & Co. Tardif, 2003). A. retroflexus se objevuje na konci května a jeho stadia senescence je od listopadu do února, jeho fenologická stadia jsou však mírně rozfázena pro různé zeměpisné šířky, s kratšími vývojovými stádii ve vyšších zeměpisných šířkách (Huang et al., 2000 Iamonico, 2010). A. spinosus se objevuje v červnu, kvete v červenci, ovoce se vyvíjí v srpnu, následuje šíření semen v září a nakonec vykazuje stárnutí v listopadu (Chakravorty & Ghosh, 2012).

      Amaranthus je dvouděložný bylinný mezofyt, který pro fotosyntézu využívá specializovanou [C4] uhlíkovou fixační dráhu, ve které je prvním produktem fotosyntézy sloučenina se čtyřmi uhlíky (National Research Council, 1984 Stallknecht a SchulzSchaeffer, 1993, Myers, 1993 a kol., 1999). Amaranthus patří do skupiny NAD-jablečný enzym metabolismu [C4] a vykazuje typickou Kranzovu anatomii ([C4] anatomii) listů, děložních listů a listenů (Wang et al., 1993 Costaa & Tardif, 2003). Jejich fotosyntetická dráha je charakterizována použitím mitochondriálního NAD-ME k dekarboxylaci malátu v Kranzových pochvách (Long et al., 1994 Long & Berry, 1996).Kombinace různých anatomických charakteristik Amaranthus, jako je [C.sub.4] metabolismus, dobře vyvinutý kořenový systém, průduchová vodivost a udržování listové plochy (Spreeth et al, 2004), vede ke zvýšené efektivitě používání C[O .sub.2] v širokém rozsahu teplot (od 25 °C do 40 °C), s vyšší intenzitou světla a vlhkostním stresem (Williams & Brenner, 1995), což této rostlině umožňuje přizpůsobit se různým geografickým podmínkám. a podmínky prostředí (Kigel, 1994). Rostliny, které používají dráhu fixace uhlíku [C4], mají tendenci vyžadovat méně vody než běžnější rostliny [C3] dráhy fixace uhlíku (National Research Council, 1984). To je důvod, proč Amaranthus funguje dobře za nepříznivých teplotních a vlhkostních podmínek ve srovnání s mnoha [C3] rostlinami, jako je pšenice a sójové boby (Stallknecht & Schulz-Schaeffer, 1993 Schippers. 2000 Spreeth et al., 2004), což naznačuje, že Amaranthus lze pěstovat v oblastech, které nejsou vhodné pro jiné plodiny (Breene, 1991 Lehmann, 1996 Brenner et al., 2000 Rana et al., 2007). Předchozí studie ukázaly, že [C.sub.4] druhy plevelů jako A. palmen, A. retroflexus a A. nul reagují pozitivně na zvýšení teploty (Guo & Al-Khatib, 2003), takže zvýšení teploty v důsledku změny klimatu by mohlo podporují invazní potenciál [C.sub.4] druhů plevelů, jako je A. retroflexus, zvýšením jejich růstu a produkce semen (Hyvonen, 2011).

      Amaranthus byl označován jako tolerantní vůči suchu (Grubben & van Sloten, 1981 Liu & Stutzel, 2002) a tato tolerance vůči suchu je způsobena jeho [C4] fotosyntetickou cestou, hlubokým a rozsáhlým kořenovým systémem, schopností přejít do režimu spánku. v podmínkách extrémního sucha (O'Brien & Price, 1983) a schopnost zastavit transpiraci prostřednictvím vadnutí a poté se snadno obnovit, když je k dispozici vlhkost (Myers, 1996). Výška rostlin, produkce sušiny a rozšíření listové plochy druhů Amaranthus pozitivně reagují na zvyšující se průměrnou denní/noční teplotu (Flint & Patterson, 1983). Iniciace květu závisí na fotoperiodě a většina druhů Amaranthus kvete, když je délka dne kratší než 12 hodin (Fuller, 1949 Huang et al, 2000 Palada & Chang, 2003). Rostliny pěstované v podmínkách krátkého dne (8 h) potřebují 14 až 16 dní k zahájení kvetení, zatímco rostliny pěstované v podmínkách dlouhého dne (16 h) potřebují přibližně 45 dní (Costea et al., 2004). O'Brien a Price (1983) uvedli, že krátké dny a vodní stres mohou podporovat kvetení této rostliny.

      Simbolon a Sutarno (1986) studovali reakce druhů Amaranthus na sníženou intenzitu světla a zjistili, že jsou středně tolerantní vůči stínu. Předchozí výzkumy ukazují, že rostliny [C4] mají vyšší rychlost fotosyntézy nasycené světlem a jsou lépe přizpůsobeny vysokým úrovním ozáření ve srovnání s rostlinami [C3], které saturují při relativně nižších intenzitách světla (Stoller & Myers, 1989 Regnier & Harrison, 1993). Stínování ovlivňuje přežití a růst rostlin tím, že mění jejich fyziologickou a morfologickou odpověď na světelné prostředí. Plevele jako Amaranthus vykazují fyziologické a morfologické adaptace na sníženou radiaci a "adaptivní plasticitu" pro přizpůsobení se prostředí omezenému na světlo (Stoller & Myers, 1989). Stoller a Myers (1989) uvedli, že A. albus reaguje na stín snížením fotosyntézy nasycené světlem, rychlosti dýchání ve tmě a tloušťky listů, zatímco zvyšuje obsah chlorofylu na jednotku objemu listu a specifickou plochu listu. A. powellii, A. retroflexus a A. tuberculatus reagují na stín snížením množství biomasy a výskytu listů a zvýšením specifické plochy listů a prodloužení stonku (McLachlan et al., 1993a, b: Steckel et al., 2003 Brainard et al., 2005). Charakterizace těchto fyziologických a morfologických reakcí tohoto rodu na stínování pravděpodobně poskytne cenné informace pro zlepšení našich mechanistických modelů konkurence mezi plodinami a plevelem a dynamiky populace plevele (Brainard et al., 2005).

      Rod Amaranthus poskytuje genetikům fascinující materiál, se kterým mohou pracovat. Základní genetické studie tohoto rodu byly zahájeny koncem 50. let 20. století s počty chromozomů (Grant, 1959b Pal, 1964) a identifikací polyploidů (Khoshoo a Pal 1972).

      Počet chromozomů se u druhů Amaranthus liší (tabulka 2). U A. albus, A. palmeri a A. retrojlexus je počet chromozomů 2n = 34 (Grant 1959b Sharma a Banik, 1965 Weaver & McWilliams, 1980) a 2n = 32 (Heiser & Whitaker, 1948 a Mulligan. 2005) byly hlášeny. U A. spinosus jsou somatické počty 2n = 34 (Baquar & Olusi 1988 Al-Turki a kol., 2000) a počty gamet n = 17 (Koul a kol., 1976 Behera & Patnaik, 1977 Behera & 192 Patnik, ) byl nahlášen. A. palmeri a A. spinosus mohou sdílet nedávné společné předky (Wassom & Tranel, 2005 Riggins et al., 2010), protože mají stejný počet chromozomů (2n = 34), pylovou morfologickou podobnost (Grant, 1959b Franssen et al. ., 2001b Gaines et al., 2012), a podobné velikosti genomu (Rayburn et al., 2005). Pal a kol. (1982) uvádí, že v rámci rodu Amaranthus se u stejného druhu příležitostně vyskytuje jak n = 16, tak n = 17. Počet chromozomů A. blitum a A. powellii je 2n = 34 (Weaver & McWilliams, 1980 Pal & Pandey, 1989 Greizerstein a kol., 1997). Počet chromozomů pro A. caudatus, A. hypochondriacus, A. cruentus a A. hybridus je normálně 2n = 32, ale příležitostně je to 34 (National Research Council, 1989), tj. tyto druhy jsou diploidy se základním počtem chromozomů 16 nebo 17. Mezi genomy A. hypochondriacus, A. caudatus a A. edulis nejsou žádné velké chromozomální rozdíly (Ramesh & Kumar, 2009).

      Amaranthus je převážně samosprašná rostlina (Murray, 1938), s různým množstvím křížení (Hauptli & Jain, 1985 Liu et al., 2012). Hybridizace mezi různými druhy byla široce popsána v rámci rodu Amaranthus (Saue.r 1950 Trucco et al, 2005b). Možnosti mezidruhové hybridizace mezi většinou druhů Amaranthus byly zdokumentovány (Murray, 1938 Sauer, 1950 Pal & Khoshoo, 1973) a někteří dokonce tento rod označovali jako „promiskuitní“ (Trucco et al., 2005b). Identifikace tří zdrojů cytoplazmatické samčí sterility u Amaranthus dláždí cestu pro další hybridizační techniky (Peters & Jain, 1985, 1987 Gudu & Gupta, 1988).

      A. retroflexus příležitostně tvoří přirozené hybridy s jinými druhy stejného rodu (Murray, 1938). Bylo publikováno, že hybridizace mezi A. palmeri a A. tuberculatus po řízeném opylení nepřináší prakticky žádné plodné potomstvo (Wetzel et al., 1999b Franssen et al., 2001a Steinau et al., 2003 Trucco et al., 2007). Hybridizace mezi A. hybridus a A. tuberculatus produkuje některé plodné F1 jedince (Murray, 1940 Trucco et al., 2007 Trucco et al., 2009), ačkoli genetická introgrese mezi těmito druhy probíhá pouze jedním směrem, od A. hybridus k A. tuberculatus (Trucco et al., 2005a, b Trucco et al., 2009). Na základě hlášených mezidruhových hybridizací u Amaranthus není stejný počet chromozomů předpokladem pro hybridizaci, nicméně hybridní potomstvo se zdá být životaschopnější a plodnější, když jejich rodičovský druh má stejný počet chromozomů, jako v případě hybridizace mezi A. hybridus a A. tuberculatus (Trucco et al., 2009).

      Existuje obava, že rezistence na glyfosát v důsledku amplifikace genu EPSPS by mohla být introgrese z A. palmeri rezistentní na glyfosát na jiné plevelné druhy Amaranthus (Culpepper et al., 2006). Potenciální mezidruhový přenos amplifikace genu EPSPS a rezistence na glyfosát v rámci rodu Amaranthus má značný evoluční a agronomický význam (Gaines et al., 2012).

      Detailní pochopení biologie semen pomáhá při vývoji účinných integrovaných systémů řízení plevele (Bhowmik, 1997). Kigel (1994) shromáždil mnoho dostupných informací o biologii semen rodu Amaranthus, včetně výzkumu účinků světla (Oladiran & Mumford, 1985 Gutterman a kol., 1992 Gallagher & Cardina, 1998a, b), teploty (Baskin & Am. Baskin, 1977 Weaver, 1984 Oladiran & Mumford, 1985 Weaver & Thomas, 1986 Ghorbani a kol., 1999), dostupnost vody, osmotický potenciál a slanost (Ghorbani a kol., 1999), hormony (Holm & 817, Miller, 9 Kepczyriski et al., 1996), typy půdy, hloubka pohřbu (Webb et al., 1987 Oryokot et al., 1997a Ghorbani et al., 1999) a další parametry prostředí (Bibbey, 1935 Siriwardana & Zimda Habhl, 1984 1987 Wiese & Binning, 1987 Forcella a kol., 1997) o klíčení semen.

      Dormance semen plevele je často indukována a regulována komplimentem genetických, fyziologických a environmentálních faktorů (Karssen, 1982 Baskin & Baskin, 1998), včetně délky dne a věku rostliny (Gutterman & Genotypic, 1997 Castor et al, 2000), sklizeň datum (Ghosh & Bruin, 1997) a teplota (Marayama et al. 1997). Během vývoje semen je dormance semen A. retrojlexus ovlivněna různými podmínkami prostředí, jako je rodičovská fotoperioda, teplotní prostředí, hnojení půdy, konkurence s jinými rostlinami (Kigel et al., 1977 Costea et al., 2004) a zastínění mateřských rostlin. rostlinou nebo ve skutečnosti pomocí přirozeného infračerveného světla (Doroszeweski, 2001). Indukce sekundární dormance (termodormance) u semen v důsledku vyšších teplot byla popsána u A. retroflexus (Baskin & Baskin, 1977, 1985a, 1990 Egley, 1989), A. caudatus (Kepczynski & Bihun, 2002), A. prettynsis Faccini & Vitta, 2005) a semena A. palmeri (Jha et al., 2010), což naznačuje, že toto chování semen uchovávaných v půdě je charakteristické pro rod Amaranthus. Výskyt takových časových změn v dormanci zahrabaných semen Amaranthus byl interpretován jako adaptace na zlepšení přežití, když jsou semena v půdě, zvláště když jsou hluboce zahrabaná (Omami et al., 1999).

      Vliv teploty a světla na klíčení semen druhů Amaranthus byl studován předchozími výzkumníky (Baskin & Baskin, 1977, 1998 Gallagher & Cardina, 1998a, b Leon & Owen, 2003 Steckel et al., 2004). Požadavek vysoké teploty pro klíčení druhů Amaranthus byl popsán Bibbey (1935), Kadman-Zahavi (1960), McWilliams et al. (1968), Baskin a Baskin (1977), Washitani a Takenaka (1984), Habib a Morton (1987), Gutterman a kol. (1992), Ghorbani a kol. (1999) a Guo a Al-Khatib (2003) (tabulka 3).

      Zralá semena Amaranthus zůstávají během podzimu a zimy v klidu (Baskin & Baskin. 1977, 1987 Jha a kol., 2007, 2008c Norsworthy & Oliveira, 2007), protože teploty během tohoto období jsou nižší než teploty potřebné pro klíčení. Po dozrání během zimy vyžadují semena druhů Amaranthus, stejně jako většina letniček, ke klíčení vysoké kolísavé teploty a na poli při nižších teplotách neklíčí až do pozdního jara až léta (Baskin & Baskin, 1977, 1987 Karssen, 1982 Benech -Arnold et al., 1990 Bouwmeester & Karssen, 1992 Faccini & Vitta, 2005), zatímco dozrávání po dobu několika dalších měsíců po zimě vede k poklesu požadavků na minimální teplotu nebo k rozšíření teplotního rozsahu pro klíčení semen (Baskin & Co. Baskin, 1977, 1987 Benech-Arnold a kol., 1990 Bouwmeester & Karssen, 1992). Semena tak získají schopnost klíčit stejně dobře při teplotách pod optimálním rozmezím 25 až 35 °C (Wright a kol., 1999 Guo & Al-Khatib, 2003).

      Ukázalo se, že kolísání teploty, jako je střídavé teplotní režimy, snižuje dormanci, zkracuje dobu do začátku klíčení a zvyšuje rychlost klíčení u různých druhů Amaranthus, jako je A. cruentus, A. gangeticus, A. hybridus, A. palmeri, A. paniculatus, A. retroflexus, A. rudis, A. spinosus a A. viridis (Santelmann & Evetts, 1971 Weaver, 1984 Oladiran & Mumford, 1985 Guo & Al-Khatib, 2003 Leon a kol., 2004, 2004, 2007 Thomas a kol., 2006 Chauhan a Johnson 2009 Jha a kol., 2010), protože střídavé teploty jsou nejpodobnější denním teplotním reakcím a mohou narušit fyzickou dormanci semen způsobenou obalem semen (McKeon & Mott, 1982).

      Minimální teplota klíčení pro A. palmeri a A. retroflexus byla >5 °C, ale optimální teplota pro maximální klíčení se uvádí od 25 do 40 °C (Evans, 1922 McWilliams et al., 1968 Baskin & Co. Baskin, 1977 Habib & Morton, 1987 Wiese & Binning, 1987 Kcpczynski a kol., 1996 Ghorbani a kol., 1999 Wright a kol., 1999 Kepczynski & Bihun, 2002 Guo & 203, Al-Khat). Dormantní semena A. retroflexus nemohou klíčit ve tmě při 25 °C a mohou klíčit buď částečně při 35 °C (Schonbeck & Egley, 1981a, b Kcpczynski et al, 2003b), nebo plně při 35-40 °C. C (Kepczynski a kol., 1996). Optimální klíčení A. caudatus a A. blitum bylo hlášeno při 35 °C, zatímco u semen A. hybridus bylo hlášeno mezi 32 a 34 °C (Washitani & Takenaka, 1984 Teitz et al., 1990 Gutterman a kol., 1992 Kcpczynski & Bihun, 2002). Oladiran a Mumford (1985) uvádějí optimální klíčení mezi 30 a 35 °C pro A. cruentus, A. hybridus, A. paniculatus a A. gangeticus. Vysoké teploty (průměrné [vyšší nebo rovné] 25 °C), tepelné amplitudy ([vyšší nebo rovné] 7,5 °C) a vysoká vlhkost půdy podporují klíčení A. palmeri a dalších druhů Amaranthus (Hartzler a kol., 1999 Wright a kol., 1999 Guo & Al-Khatib, 2003 Steckel a kol., 2004 Jha a kol., 2008b, c, 2010).

      Semena A. spinosus reagují pozitivně při střídavém teplotním režimu 20, 25 a 30 °C a nepříznivě při 35 °C a při 15 °C nedochází ke klíčení, ale při konstantních teplotách dochází k výraznému klíčení. byla zaznamenána při 30 °C a 35 °C (Steckel et al., 2004). Semena A. viridis klíčila v rozmezí 20 až 40 °C s 30 °C jako optimální teplotou pro klíčení (Thomas et al., 2006), zatímco při 10 °C nebylo pozorováno žádné klíčení ( Cristaudo a kol., 2007).

      Kigel (1994) uvedl, že většina druhů Amaranthus reaguje na světlo, ale úroveň odezvy se u jednotlivých druhů liší (Gallagher & Cardina, 1998a, b Cristaudo et al., 2007), v závislosti na úrovni dormance semen, která je dále ovlivněna. faktory, jako je pohřeb a teplota (Gallagher & Cardina, 1998a Leon & Owen, 2003). Potřeba světla pro klíčení byla hlášena u různých druhů Amaranthus, jako je A. blitum, A. caudatus, A. hybridus, A. retroflexus, A. rudis, A. spinosus a A. viridis (Baskin & Baskin, 1977 Schonbeck & Egley, 1981a, b Teitz a kol., 1990 Gallagher & Cardina, 1998a, b Leon & Owen, 2003 Cristaudo a kol., 2007). Semena A. spinosus, A. retroflexus a A. viridis klíčí lépe na světle než ve tmě, což znamená, že pohřbená semena vyklíčí po narušení půdy (Baskin & Baskin, 1977, 1985b, 1998 Omami & Medd, 1992 Gallagher & Cardina, 1998a, b Benvenuti a kol., 2001 Cristaiido a kol., 2007). Ekologický význam připisovaný světelné reakci u různých druhů Amaranthus spočívá v tom, že světlo funguje jako „indikátor“ hloubky půdy nebo mechanismus hloubkového snímání semen, což umožňuje větší klíčení povrchových semen než semen pohřbených v půdě (Ghorbani et al., 1999 Schutz a kol., 2002).

      Klíčení semen různých druhů Amaranthus, jako je A. arenicola, A. cauda tus, A. hybridus, A. palmeri, A. retroflexus a A. rudis, bylo dokumentováno fytochromem regulované (Hendricks et al., 1968 Kendrick & Frankland, 1969 Kendrick a kol., 1969 Taylorson & Hendricks, 1969, 1971 Gallagher & Cardina, 1998a, b Leon & Owen, 2003 Jha a kol., 2010). Vystavení červenému (R) světlu indukuje klíčení semen donnant (Jha et al., 2010) a tento účinek je výraznější u chlazených semen (vlhká stratifikace při 4 °C) ve srovnání se semeny nechlazenými, což naznačuje interakci nízkých teplot s fytochromem při zmírnění dormance (Taylorson & Hendricks, 1969 Gallagher & Cardina, 1997, 1998a, b Leon & Owen, 2003). Vysoké teploty (30 °C nebo vyšší) během léta však mohou snížit fotosenzitivitu semen Amaranthus a překonat fytochromem zprostředkovaný požadavek na červené světlo pro lepší klíčení u různých druhů Amaranthus, jako je A. hybridus, A. retroflexus a A. rudis. (Gallagher & Cardina. 1998a Hartzler a kol., 1999 Leon & Owen, 2003). Na druhé straně FR světlo inhibuje klíčení a vyvolává dormanci (Kendrick & Frankland. 1969 Taylorson & Hendricks, 1971 Gallagher & Cardina, 1998a Leon & Owen, 2003 Jha a kol., 2010). Tento inhibiční účinek FR světla je způsoben snížením Pfr/Pr fytochromu, což způsobuje foto dormanci v semenech (Hendricks et al., 1968 Kendrick & Frankland, 1969 Taylorson & Hendricks, 1969, 1971).

      Vliv půdních typů, hloubka zahrabávání semen a doba zahrabávání semen

      Procento vzejití A. retroflexus je větší v lehčích půdách (písčitá hlína, hlinitý písek a písčitá hlína) než v těžších půdách (jílovitý jíl a písčitý jíl). Maximální vzejití nastává v hloubce 0,5 cm ve třech lehčích půdách, mezi 0,5 a 2 cm v písčitém jílu a 3 cm hluboko v bahnitém jílu (Ghorbani et al., 1999), pravděpodobně kvůli špatné výměně plynů, špatnému osvětlení, a nižší teplota v těžších půdách (Gallagher & Cardina, 1998a).

      Zahrabaná semena plevelů tvoří důležitou součást půdní semenné banky (Baskin & Baskin, 1985b, 1998 Benvenuti et al, 2001) a poloha, distribuce a úroveň dormance těchto semen v půdě hrají důležitou roli při jejich klíčení a následném vzcházení ( Burnside a kol., 1981 Benvenuti & Macchia, 1997 Benech-Arnold a kol., 2000), která je dále ovlivněna faktory, jako je teplota půdy, vlhkost půdy a dostupnost světla. Plevele s drobnými semeny, jako je druh Amaranthus, mohou klíčit pouze z mělkých půdních hloubek 0,5 až 2,5 cm (Baskin & Baskin, 1977, 1998 Buhler a kol., 1996 Oryokot a kol., 1997a Gallagher & B198 Cardina, al., 1999 Benech-Arnold a kol., 2000 Leon & Owen, 2003).

      Santelmann a Evetts (1971) zkoumali vzcházení u několika druhů Amaranthus a zjistili, že klíčivost klesá v hloubkách pod 1,9 cm. Zvýšení dormance semen zahrabaných v hloubce 5 až 10 cm po dobu 3 až 12 měsíců bylo hlášeno u jiných druhů Amaranthus (Baskin & Baskin, 1977 Omami et al., 1999). Ghorbani a kol. (1999) pozorovali in-situ vzorce vzniku A.retroflexus a dospěl k závěru, že optimální hloubka pohřbu byla mezi 0,5 a 3 cm, bez vynoření v 5 cm. V polních podmínkách také semena A. retroflexus vykazovala pokles klíčivosti se zvýšením hloubky zahrabání z 0 na 10 cm (Wiese & Davis, 1967 Omami et al., 1999). Benvenuti a kol. (2001) také uvedli pokles vzcházení semenáčků A. retroflexus se zvýšením hloubky zahrabání a bylo zjištěno, že vzcházení bylo menší než 10 % při hloubce pohřbu 8 cm. Kromě toho semena A. viridis na povrchu půdy měla sníženou vzejitost ve srovnání se semeny umístěnými těsně pod povrchem a klíčení bylo optimální z mělkých půdních hloubek 0,5 až 2 cm, ale některé semenáčky vzešly až z hloubky 6 cm (Thomas a kol., 2006). Omezený kontakt mezi půdou a semenem, světelné podmínky na povrchu a dostupnost vody nebo nižší potenciál vody v půdě v blízkosti semene jsou některé environmentální podmínky, které mohou omezovat klíčení semen na povrchu půdy (Ghorbani et al., 1999). Vzcházení sazenic na povrchu půdy bylo nižší než klíčení pozorované u Petriho misek na světle (Chauhan & Johnson, 2009). Tento rozdíl může být způsoben špatným kontaktem půdy se semeny nebo omezenější dostupností vlhkosti na povrchu půdy než na filtračních papírech (Ghorbani et al, 1999).

      Semena A. spinosus a A. viridis vylézají stejnou rychlostí od 0,5 cm do 2 cm, ale jak se hloubka zahrabání zvětšuje, vzejití A. spinosus klesá rychleji než u A. viridis, aniž by se objevila ze 4 cm v dříve a pouze 6% vzejití u pozdějších, zatímco v hloubce 6 cm nebylo pozorováno žádné vylíhnutí ani u jednoho druhu (Chauhan & Johnson, 2009). Větší semena s většími zásobami sacharidů mají zvýšenou schopnost vynořit se z větších hloubek pohřbu ve srovnání se semeny s nižšími zásobami (Baskin & Baskin, 1998). Větší hmotnost semen A. viridis (více než dvakrát než u A. spinosus) by mohla vysvětlit její schopnost vynořit se hlouběji v půdě než A. spinosus (Chauhan & Johnson, 2009). Druhy malosemenných širokolistých plevelů, jako je A. retroflexus, A. spinosus, A. viridis a několik dalších druhů Amaranthus, mají podobný vzorec vzcházení kvůli omezeným zásobám sacharidů na podporu klíčení a vzcházení sazenic, čímž se omezuje hloubka, ze které tyto druhy rostou. mohou vzejít semenáčky (Webb a kol., 1987 Santelmann & Evetts, 1971 Ghorbani a kol., 1999 Thomas a kol., 2006 Chauhan & Johnson, 2009) (tabulka 4).

      Získání hloubkově zprostředkované dormance semen plevelů (Milberg & Andersson, 1997 Benvenuti et al., 2001) je důležitou strategií, která umožňuje dlouhověkost a zachování semen plevele v půdě semenné banky (Thompson, 1987 Benvenuti et al., 2001 ), a je známo, že k němu dochází v důsledku nedostatečné propustnosti světla, poklesu teplotních výkyvů, poklesu kyslíku, zvýšení oxidu uhličitého a nízké rychlosti plynné difúze s rostoucí hloubkou půdy (Holm, 1972 Woolley & Stoller, 1978 Baskin & Baskin , 1985b Drew, 1990 Benvenuti & Macchia, 1997, 1998 Gallagher & Cardina, 1998a Benvenuti a kol., 2001 Benvenuti, 2003).

      Kromě toho kolísání teploty, o kterém se uvádí, že má vliv na zmírnění dormance semen druhů Amaranthus (Baskin & Baskin, 1977, 1985b Omami a kol., 1999 Guo & Al-Khatib, 2003 Leon & Owen, 2003. Steckel 2004 Cristaudo et al., 2007), klesají s rostoucí hloubkou půdy, a tak působí jako mechanismus hloubkového snímání pro semena plevelů (Ghersa et al., 1992 Baskin & Baskin, 1998 Kegode et al., 1998). Gutterman a kol. (1992) a Kepczynski a kol. (1996) uvádí, že nespící semena Amaranthus potřebují ke klíčení alespoň 10 % kyslíku. Ale s rostoucí hloubkou zahrabání dochází k poklesu koncentrace kyslíku, což vede k hypoxii a inhibici klíčení semen některých druhů plevelů (Holm, 1972).

      Milberg a Andersson (1997) uvedli, že zahrabání do půdy vyvolalo u některých semen plevelů potřebu světla. Požadavek klíčení na červené světlo vyvolaný zakopáním vedl k posunu od reakce nízké fluence (LFR) k velmi nízké fluence reakci (VLFR) fytochromu v semenech A. retroflexus a A. hybridus (Scopel et al., 1991 Smith, 1995 Gallagher & Cardina, 1998a, b), což lze také očekávat u jiných druhů Amaranthus.

      Doba zahrabávání semen také hraje důležitou roli při dormanci a klíčení semen plevelů, jako je A. patulus (Baskin & Baskin, 1985b, 1998 Washitani, 1985) (tabulka 4). Washitani (1985) uvedl, že pouze zanedbatelné množství zakopaných semen A. patulus si po 3 letech zakopání zachovalo klíčivost. Omami a kol. (1999) popsali cyklické změny v dormanci a klíčení semen A. retroflexus během 12měsíčního pohřbívání. Klíčivost semen A. retroflexus a A. palmeri klesla po 1 až 3 měsících od zakopání semen. Vrchol klíčení nastal po 9 měsících a opět poklesl po 12 měsících po zakopání semen (Omami et al., 1999 Jha et al., 2010). Zakopaná semena A. retroflexus mohou zůstat životaschopná po dobu alespoň 6-10 let (Chepil, 1946a Weaver & McWilliams, 1980 Burnside a kol., 1981, 1996 Costea a kol., 2004). V Bealově experimentu v Michiganu vyklíčila 2 % semen A. retroflexus po 40 letech pohřbu (Telewski & Zeevaart, 2002).

      Efekt stínu a orby

      Jemné rozdíly v půdním mikroklimatu mohou mít velký vliv na klíčení semen plevelů včetně druhu Amaranthus (Mohler, 1993 Buhler et al., 1996 Oryokot et al., 1997a). Účinky stínu a zpracování půdy na vlastnosti vzejití druhů Amaranthus, jako jsou A. retroflexus a A. rudis, byly již dříve studovány (Anderson & Nielsen, 1996 Oryokot a kol., 1997a Hartzleret al., 1999 Cardina a kol., 2002 Leon & Owen, 2006).

      Vliv skarifikace a stratifikace

      Santelmann a Evetts (1971) pozorovali, že semena A. spinosus klíčí nejlépe, když jsou ošetřena kyselinou sírovou. Mechanická nebo chemická skarifikace kyselinou sírovou po dobu 1 až 5 minut vedla ke klíčení sekundárních dormantních semen A. caudatus při 25 °C (Kepczynski & Bihun, 2002). Ošetření různými koncentracemi acetonu, ethanolu, ethylenu, peroxidu vodíku, kyanidem draselným, azidem sodným a kyselinou sírovou bylo velmi účinné při narušení dormance semen Amaranthus a podpoře klíčení (Taylorson & Hendricks, 1973 Mahmudzadeh et al., 2003). Soomarin a kol. (2010) ošetřili semena A. retroflexus kyselinou sírovou a uvedli, že s prodlužujícím se trváním ošetření se rychlost klíčení semen Amaranthus zvýšila z 2 % (u kontroly) na 78,5 % (při 25minutové předúpravě). . Délka a hmotnost kořene se však snížily (Evans, 1922 Mahmudzadeh et al., 2003 Soomarin et al., 2010).

      Stratifikace, účinný způsob zmírnění dormance semen (Bewley & Black, 1994), uvolňuje dormanci semen A. retroflexus a A. rudis postupně v průběhu času (Leon & Owen, 2003 Kepczynski & Sznigir, 2012) a zvyšuje procento klíčení semen, ale rychlost Klíčení při 35 °C bylo vyšší než při 25 °C po každém období stratifikace (Taylorson & Hendricks, 1969 Kcpczynski & Sznigir, 2012). Semena A. retroflexus pěstovaná při krátké délce dne měla vyšší klíčivost v reakci na stratifikaci za studena než semena pěstovaná při délce dlouhého dne (Kigel et al., 1977).

      Stratifikace při konstantní teplotě byla méně účinná při uvolňování dormance než podzimní a zimní zahrabávání semen z toho důvodu, že v půdě jsou semena vystavena nejen kolísajícím teplotám, ale také několika dalším faktorům, jako jsou roztoky sloučenin, plyny a půda. mikroorganismy, které mohou ovlivnit stav dormance semen Amaranthus (Kcpczynski & Sznigir, 2012). Moore (1979) poukázal na to, že chlazení na 4 °C zvyšuje endogenní GA a snižuje koncentraci ABA, proto je možné, že zmírnění dormance v semenech některých druhů stratifikací nebo částečným zahrabáním je spojeno se změnami ABA/GA a ethylenu. rovnováha a/nebo citlivost na tyto hormony (Cadman et al., 2006 Rodriguez-Gacio et al., 2009).

      Ekonomický význam rodu Amaranthus

      Složení a nutriční hodnota Amaranthus

      Role Amaranthus jako nedostatečně využívané rostliny se slibnou ekonomickou hodnotou byla uznána Národní akademií věd, USA (NAS, 1975), načež byla její nutriční hodnota rozsáhle studována (Becker et al., 1981 Teutonico & Knorr, 1985 Petr a kol., 2003).

      Listy amarantu vykazují významnou energetickou hodnotu v rozmezí 27 až 53 kcal/100 g čerstvých listů a vysokou nutriční hodnotu v rozmezí 4 až 6 g bílkovin, 0,2 až 0,6 g tuku a 4 až 7 g sacharidů na 100 g čerstvého listy (Uusikua et al., 2010) a je známo, že jsou bohaté na mikroživiny a vitamíny, zejména chlór, měď, železo, mangan, sodík, vitamín A, vitamín C a vitamín B-12 (Mnkeni, 2005). Listy amarantu chutnají podobně jako špenát, ale jsou nutričně lepší, protože obsahují 3x více vitamínu C, vápníku a niacinu než špenát (Mnkeni, 2005). Ve srovnání s hlávkovým salátem obsahují listy Amaranthu 18x více vitamínu A, 13x více vitamínu C, 20x více vápníku a 7x více železa (Mnkeni, 2005 Srivastava, 2011).

      Semena amarantu mají obsah bílkovin asi 12,5 až 17,6 % (Becker et al., 1981 Teutonico & Knorr, 1985), s výrazně vyšším obsahem lysinu (0,73 až 0,84 % celkového obsahu bílkovin) a aminokyselin obsahujících síru ( methionin a cystein) než jiná obilná zrna (Becker et al., 1981 Saunders & Becker, 1984 Railey, 1993 Lehmann, 1996 Petr et al., 2003) kromě sojových bobů (Petr et al. 2003), čímž mají potenciál zlepšit světovou potravinu situaci jako alternativní zdroj bílkovin (Oliveira & de Carvalho, 1975).

      Semena Amaranthus mají vynikající profil aminokyselin, který by se v kombinaci s kukuřicí nebo rýží přiblížil modernímu standardnímu proteinu doporučenému FAO/WHO (FAO, 1973 Senft, 1980 Teutonico & Knorr, 1985 Singhal & Kulkarni, 1988) a je užitečný při doplňování výživné stravy a zmírňování deficitu bílkovin striktně u lidí s vegetariánskou stravou (Downtown, 1973 Senft, 1980 Railey, 1993).

      Obsah lipidů v semenech Amaranthus je typicky 6 až 20 % (Lorenz & Hwang, 1985 Garcia a kol., 1987a Budin a kol., 1996). Semena i listy amaranthu jsou dobrým zdrojem nenasycených mastných kyselin, jako je palmitová, olejová, linolová. a linolenové kyseliny (Fernando & Bean, 1984 Jahaniaval a kol., 2000 Leon-Camacho a kol., 2001). Přestože se semeno Amaranthus nepovažuje za typickou olejninu, bylo identifikováno jako bohatý zdroj (2,4 až 8 %) skvalenu (2,6,10,15,19,23-hexamethyl-2,6,10,14, 18,22-tetrakosahexaen) a tokotrienoly (forma vitaminu E) (Budin a kol., 1996 Lehmann, 1996 Sun a kol., 1997). Skvalen je drahá terpenoidní sloučenina, pocházející primárně z jater žraloka (Cantrophorus squamosus) a velrybího oleje (Physeter macrocephalus). Vzhledem k zájmu o ochranu mořských živočichů se pozornost soustředila na identifikaci rostlinných zdrojů skvalenu (Sun et al., 1997). Skvalen je důležitou složkou v kosmetice, léčivech a lubrikantech pro počítačové disky (Sun a kol., 1997 Budin a kol., 1996). Skvalen i tokotrienoly mohou hrát důležitou roli při snižování LDL-cholesterolu v krvi (Railey, 1993 Budin et al., 1996 Lehmann, 1996) a působí tak jako ochranné faktory proti srdečnímu infarktu, který je způsoben isoproteronolem (Farvin et al., 2006).

      Semena amarantu jsou bohatým zdrojem vápníku (1300 až 2850 mg/kg), železa (72 až 174 mg/kg), hořčíku (2300 až 3360 mg/kg), sodíku (160 až 480 mg/kg) a zinku (36,2 do 40 mg/kg) steroly (0,27-0,32 mg/g) a také vitamín riboflavin (0,19-0,23 mg/100 g mouky) a kyselinu askorbovou (4,5 mg/100 g mouky), niacin (1,17 až 1,45 mg /100 g mouky), thiamin (0,07 až 0,1 mg/100 g mouky) a další mikroprvky (Becker et al, 1981 Plate and Areas, 2002).

      Je známo, že některé druhy Amaranthus, když rostou ve stresových podmínkách, akumulují toxické hladiny oxalátů a dusičnanů (Der Marderosian a kol., 1980 Saunders & Becker, 1984 Wills a kol., 1984) a tyto dusičnany mohou být po konzumaci chemicky změněny. v trávicím traktu na jedovaté/karcinogenní nitrosaminy.

      Aplikace Amaranthus

      Amaranthus je jednou z mála vysoce výživných víceúčelových plodin a používá se jako zelenina, obilnina, léčivá rostlina, barvířská rostlina, píce, palivo a jako okrasná rostlina. (Sauer, 1950 Oke, 1983 Saunders & Becker, 1984 Railey, 1993 Mlakar a kol., 2009 Sheikh & Singh, 2013).

      Červené barvivo z listů různých druhů Amaranthus se používá k barvení potravin, alkoholických nápojů a kukuřičného těsta (Sauer, 1950). V Mexiku se semena Amaranthus používají hlavně k výrobě bonbónů alegria z pražených semínek a melasy (Early, 1977) a k přípravě atole, nápoje z pražených a práškových semen smíchaných se sirupem a vodou (Oke, 1983). V Indii se A. hypochondriacus, běžně známý jako „rajgeera“ (královské obilí), široce pěstuje jako vedlejší potravinářská plodina od Kašmíru po Arunáčalpradéš a často se používá v cukrovinkách nazývaných „laddoos“ (Vietmeyer, 1978). které jsou velmi podobné mexické „alegrii“. V Nepálu se semena Amaranthus konzumují jako kaše zvaná „sattoo“ nebo se melou na mouku, aby se vyrobily chappatis (Vietmeyer, 1978 Singhal & Kulkami, 1988). Listy amarantu se používají v krémech, pastách, polévkách, dušených pokrmech, salátech, vařené a smíchané s arašídovou omáčkou (Oliveira & de Carvalho, 1975 National Research Council, 1984).

      Různé druhy Amaranthus (A. blitum, A. caudatus a A. spinosus) se konzumují jako zelenina v Africe, Karibiku, Číně, Řecku, Indii, Itálii, Nepálu a na ostrovech jižního Tichomoří (Stallknecht & Schulz-Schaeffer, 1993). Na základě využití pěstovaných laskavců pro lidskou spotřebu lze druhy rozdělit na laskavce obilné a zeleninové. Amaranthus není "pravá obilovina", spíše patří do skupiny obilnin podobných obilninám nebo "pseudocereálií" (O'Brien & Price, 1983). Pseudocereálie jsou dvouděložné druhy, které nejsou blízce příbuzné mezi sebou ani s jednoděložnými pravými obilninami (Shewiy, 2002).

      Semena Amaranthus mohou být mletá a zahrnuta jako přísada mouky do různých směsí pro sušenky, chléb, sušenky, krekry, palačinky, knedlíky, muffiny, nudle, palačinky, pudinky a další cukrovinky (National Research Council, 1984 Mlakar et al., 2009 Sanz-Penella et al., 2013) a také kombinace amarantové a pšeničné mouky zvyšuje nutriční hodnotu pečených výrobků (Saunders & Becker, 1984 Segura-Nieto et al., 1994 Mlakar et al., 2009).

      Amaranthus má antialergické, protirakovinné, antihypertenzní a antioxidační vlastnosti (Conforti et al, 2005 Castelano-Sousa & Amaya-Farfan, 2012) a chrání před několika poruchami, jako jsou tendence ke krvácení, mozková mrtvice, celiakie, vadné vidění, cukrovka, poruchy trávení, funkční sterilita, krvácení, srdeční choroby, HIV/AIDS, hypertenze, kwashiorkor, leucorrhoea, onemocnění jater, marasmus, předčasné stárnutí, opakující se nachlazení, infekce dýchacích cest, zpomalený růst, kožní onemocnění, TBC a hojení ran (Thompson, 2001).

      Fytoremediační potenciál rodu Amaranthus

      Absorpce těžkých kovů druhem Amaranthus byla nedávno studována v půdách na skládkách odpadu, na skládkách živočišného odpadu a v jiných formách kontaminovaných půd (Adekunle et al, 2009 Adefila et al., 2010 Adefemi et al., 2012 Akubugwo et al. , 2012 Shagal a kol., 2012). Rostliny A. caudatus pěstované na skládkách obsahují vyšší koncentraci těžkých kovů jako Fe, Cu, Pb, Zn, Mn, Cd (Adewuyi et al, 2010). A. hybridus pěstovaný na skládkách měl vyšší koncentraci těžkých kovů jako Fe, Zn, Cd, Cr, Cu, Ni, Pb, Mn a Hg (Akubugwo et al., 2012). Hodnocení obsahu těžkých kovů v rostlinách pěstovaných na skládkách poskytuje cenné údaje o fytoakumulačním potenciálu těžkých kovů těchto rostlin (McIntyre & Lewis, 1997). A. retroflexus byl identifikován jako kovový akumulátor (Bigaliev et al., 2003 Mellem, 2008). A. spinosus je potenciální činidlo pro akumulaci a translokaci těžkých kovů, jako je Cu, Zn, Cr, Pb a Cd (Chinmayee et al., 2012). A. tricolor má vysokou schopnost akumulovat kadmium (Watanabe et al., 2009). A. viridis má ve svých tkáních metodu koncentrace těžkých kovů, zejména Pb a Cd (Atayese et al., 2009). To naznačuje, že tyto druhy Amaranthus mohou sloužit jako fytoakumulátory těžkých kovů a mohou být použity pro účely fytoremediace.

      Rod Amaranthus obsahuje jedny z nejhorších [C.sub.4] plevelů na světě (Holm et al., 1977) a jeho několik druhů je trvale řazeno mezi 10 nejobtížnějších plevelů v jihovýchodních Spojených státech (Dowler, 1995 Webster, 2009), které působily fanouškům problémy od poloviny 90. let. Devět druhů Amaranthus je uvedeno jako „invazivní nebo škodlivé plevele“ v databázi rostlin USDA a dalších 20 druhů je uvedeno jako „zemědělské plevele“ v Global Compendium of Weeds (Randall, 2007 USDA, NRCS, 2010).

      Několik druhů Amaranthus, jako jsou A. retroflexus, A. spinosus a A. viridis (Yan et al., 2001), A. blitum (Costea & Tardif, 2003), A. albus, A. powellii a A. rudis (Ortiz Ribbing & Williams, 2006) a A. palmeri (Kendig, 2009), je známo, že konkurují mnoha ekonomickým plodinám včetně obilovin a zeleniny v různých částech světa a způsobují velké ztráty na výnosech (Holm et al., 1977 Menges, 1988 Monks & Oliver, 1988). Plevelné druhy Amaranthus jsou označovány jako „oportunisté“ (Sauer, 1955) kvůli skutečnosti, že se jim daří v narušených půdách a mají tendenci být spojovány se zemědělskými postupy. Jsou schopny konkurovat plodinám o vodu, živiny a světlo, což způsobuje vážné snížení výnosu, kvality a efektivity sklizně (Vangessel & Renner, 1990) a jejich vysoká konkurenceschopnost může souviset s jejich plodnou produkcí semen, prodlouženou životaschopností semen, dormance semen. , rychlost a načasování klíčení, dlouhá doba klíčení, agresivní růst při vyšších teplotách díky rozsáhlému kořenovému systému, termostabilita [C.sub.4] fotosyntetického mechanismu, vysoká účinnost využití vody a vysoká hustota napadení (Weaver & McWilliams , 1980 Knezevic & Horak, 1998 Horak & Loughin, 2000 Aguyoh & Masiunas, 2003 Massinga et al., 2003), která je dále posílena díky vývoji biotypů Amaranthus odolných vůči herbicidům (Heap 2014). Kromě toho se jejich konkurenceschopnost liší podle druhu, hustoty a doby vzejití vzhledem k plodině (Klingaman & Oliver, 1994 Knezevic & Horak, 1998).Alelopatické účinky mohou také interagovat se soutěží o zdroje mezi některými druhy Amaranthus a plodinou, ve které rostou (Connick et al., 1987 Bradow & Connick, 1988 Menges, 1988).

      A. blitum je uveden jako závažný nebo hlavní plevel v deseti zemích, zejména v Evropě a Asii (Holm a kol., 1979 Takabayashi & Nakayama, 1981 Walter & Dobes, 2004) a vyskytuje se v široké škále polních a zahradnických plodin. , pastviny, sady, plantáže a vinice.

      A. palmeri je nejobtížnějším plevelem v jihovýchodních Spojených státech (Dowler, 1995 Norsworthy, 2003) a je známo, že způsobuje vážné interference a ztráty výnosů u různých zemědělských plodin, jako je Arachis hypogaea (Horak & Loughin, 2000 Burke et al., 2007 ), Glycine max (Monks & Oliver, 1988 Klingaman a Oliver 1994 Dieleman a kol., 1995 Bensch a kol., 2003 Norsworthy, 2003), Gossypium hirsutum (Keeley & Thullen, 1989, 1997, Morganow, 1989, 1997, Dowler. al., 1999 Smith et al., 2000 Morgan et al., 2001), Ipomoea batatas (Meyers et al., 2010), Sorghum bicolor (Moore et al., 2004) a Zea mays (Massinga et al., 2001 Massinga & Currie, 2002 Massinga a kol., 2003).

      A. retroflexus, jeden z deseti druhů plevelů s největším ekonomickým významem v Evropě (Schroeder et al., 1993) je běžným plevelem obdělávaných polí v mnoha zemědělských oblastech světa (Weaver & McWilliams 1980 Horak & Loughin, 2000), který je schopen zamořit a snížit výnosy plodin, jako je Beta vulgaris, Brassica napus (Hendrick a kol., 1974), Glycine max (Orwick & Schreiber, 1979 Dieleman a kol., 1995 Cowan a kol., 1998 Bensch a kol., 2003), Gossypium hirsutum (Buchanan et al., 1980), Helianthus annus (Heidarian et al., 2012), Phaseolus sp. (Aguyoh & Masiunas, 2003), Solanum tuberosum (Vangessel & Renner, 1990), Zea mays (Knezevic et al., 1994). a další zelenina (Weaver & McWilliams, 1980).

      A. spinosus byl hlášen jako plevel ve 28 plodinách a 44 zemích v Indii, jihovýchodní Asii a na západě a jihu Afriky (Waterhouse, 1994 Chauhan a Johnson 2009). Vyskytuje se jako plevel různého významu v různých plodinách, jako je Ananas comosus, Arachis hypogaea, Celosia argentia, Corchorus olitorius, Glycine max, Gossypium hirsutum, Oryza sativa, Saccharum ofjicinamm, Soighum bicolor, Zea mays (Ogunyemi et al.200 Ogunyemi et al., 2005 Chauhan & Johnson, 2009) a zahradnické podniky (Waterhouse, 1994). Pozoruhodným příkladem nedávné invaze plevele je A. tuberculatus na polích kukuřice a sóji v centrálních Spojených státech během posledních dvou desetiletí (Steckel, 2007). A. tuberculatus byl poprvé zaznamenán jako zemědělský plevel na kukuřičných polích v Illinois na počátku 50. let 20. století (Sauer, 1957) a od 90. let se stal velkým problémem (Trucco et al. 2009). Ztráty na výnosu způsobené interferencí od různých jiných druhů Amaranthus byly hlášeny u mnoha plodin (Moolani et al., 1964 Rushing et al., 1985 Bensch et al., 2003 Hartzler et al., 2004).

      Byly hlášeny alelopatické účinky různých druhů Amaranthus na různé rostliny (tabulka 5). Suché zbytky nadzemní části A. retroflexus snižovaly klíčivost Beta vulgaris, Brassica oleracea, Brassica oleracea var. brotrytis, Capsicum annuum, Carthamus tinctorius, Cucumis sativus, Cucurbita ovifera, Daucus carota. Glycine max, Gossypium hirsutum, Helianthus annus, Hordeum vulgare. Lactuca sativa, Lycopersicon lycopersici, Phaseolus vidgaris, Solanum melongena. Sorghum bicolor a Zea mays (Munger et al., 1983 Qasem, 1995a, b Alam et al., 2001 Aguyoh & Masiunas, 2003 Costea & Tardif, 2003 Dos Santos et al, 2004 Yaamp 100al 2901, Souzaie & 01 .

      Zbytky výhonků A. retroflexus inhibovaly prodlužování kořenů a hypokotylu, interferovaly s fotosyntézou, snižovaly růst, příjem živin a produktivitu Zea mays (Bhowmik & Doll, 1980, 1982, 1984) a snižovaly dýchání, relativní rychlost růstu (RGR), čistou asimilaci rychlost (NAR), čerstvá hmotnost kořene (FWR), fixace nodulů dusíkem, obsah chlorofylu a produkce biomasy v Glycine max (Bhowmik & Doll, 1980, 1982, 1984 Chaniago et al., 2006) snížily růst a výnos u Nicotiana tabacum ( Lolas, 1981 Lolas, 1986) ovlivnil růst a usazování fazolí (Shimi & Termeh, 2004) a snížil výnos světlice barvířské (Williams et al., 2005) uvolněním alelochemikálií, ale. inhibice nebyla znatelně ovlivněna teplotou nebo světlem (Bhowmik & Doll, 1983). Usušené zbytky výhonků A. retroflexus, A. blitoides a A. gracilis snižovaly klíčivost, délku koleoptilů, délku kořene, suchou hmotnost kořene, výšku rostliny, výnos zrna a slámy Triticum aestivum (Qasem, 1995b Shahrokhi et al., 2012) a způsobilo snížení produktivity Hordeum vulgare (Qasem, 1994, 1995a).

      Alelopatické účinky A. palmeri byly popsány na vzejití semenáčků několika druhů (Menges, 1987, 1988). Extrakty A. palmeri inhibovaly klíčení semen a růst Daucus carrota a Allium cepa (Altieri a Doll 1978 Bradow & Connick, 1987 Menges, 1987). Páry 2-heptanonu a 2-heptanolu, izolované z A. palmeri, inhibovaly klíčení semen cibule, mrkve, rajčat a palmového amarantu (Connick et al., 1987). Menges, (1988) uvádí fytotoxicitu zbytků A. palmeri na růst několika druhů plodin, včetně Sorghum bicolor, Brassica oleracea var. Capitata, Daucus carrota a Allium cepa. Ve vodě rozpustné extrakty z A. palmeri byly fytotoxickější než extrakty z A. retroflexus (Hicks et al., 1986).

      Byly popsány alelopatické účinky A. spinosus (Shrefler et al., 1996). Extrakt z listů a květenství A. spinosus drasticky snížil vegetativní a reprodukční fázi Sinapis alba a T. aestivum (Datta & Bandyopadhayay, 1981). Vyluhované složky A. spinosus vykazovaly silný alelopatický účinek na růst a usazování Parthenium hysterophorus (Chikkalingaiah & Mahadevappa, 1998) a také na růst některých kultur (Suma, 1998).

      Spálené zbytky A. viridis snížily růst a produktivitu Pennisetum americanum (Singhal & Sen. 1981). Rovněž bylo zjištěno, že vodné extrakty A. dubius inhibují sazenice emergencz a růst několika druhů rostlin (Altieri & Doll, 1978). Suché extrakty výhonků A. hybridus negativně ovlivnily celkový obsah chlorofylu, počet vyvinutých listů, délku stonku a celkovou rostlinnou sušinu suchých fazolí (Amini et al., 2013).

      Bylo zjištěno, že alelochemikálie, jako jsou aldehydy, alkaloidy, apokarotenoidy, flavonoidy, steroidy, xyloidy, klerogenní kyselina a saponiny (Anaya a kol., 1987 Aim a kol., 2002), vylučované vzdušnými orgány rostlin Amaranthus, se uvolňují deštěm. nebo závlahovou vodou do půdy (Anaya a kol., 1987 Al-Khatib, 1995 Khanh a kol., 2005).

      Fischer a Quijano (1985) izolovali fytol, chondrillasterol, vanilin, 3-methoxy-4-hydroxynitrobenzen a 2,6-dimethoxybenzochinon z A. palmeri. Kumariny byly izolovány z A. retroflexus (Rezaie & Yarnia, 2009). Hlavní alelochemikálie přítomné v A. spinosus byly fenolové kyseliny, alkaloidy patřící do třídy chinolizidinů, steroidní, indolové a seskviterpenové laktony (Narwall 1994 Qasem 1995a Velu & Ali, 1995 Suma, 1998). Množství fenolových kyselin v A. spinosus bylo největší u rostlin rostoucích v půdách znečištěných domácími, průmyslovými a vehikulovými zbytky (Suma, 1998), zatímco koncentrace fenolových kyselin v rostlině byla nejvyšší v listech, následovaných stoncích, květenství a nejnižší v kořenech (Souza et al., 2011).

      Plevelné druhy Amaranthus se obtížně kontrolují kvůli jejich plodné produkci semen (200 000 až 600 000 semen/samičí rostlina), malé velikosti semen, schopnosti úspěšně se křížit s jinými druhy amaranthu, dlouhé době klíčení, vysoké hustotě napadení, schopnosti rychle se vyvíjet herbicid odolnost a potíže se správnou identifikací (Stevens, 1932 Keeley et al., 1987 Dillon et al., 1989 Horak, 1997 Wetzel et al., 1999a, b Sellers et al., 2003 Vigueira et al., 2013). I když správná identifikace druhů Amaranthus může být obtížná, je důležitá vzhledem k různým reakcím na herbicidy a postupy ochrany proti plevelům (Pratt et al, 1999).

      Stín může mít supresivní účinek na geninaci semen plevele, protože tlumí amplitudu půdy a mění kvalitu světla vnímanou semeny ležícími na povrchu půdy (Fortin & Pierce, 1990 Batlla et al., 2000 Norsworthy, 2004). Pod baldachýnem, kromě snížení PAR, semena zažívají snížení poměru červená: daleko-červená (R:FR) v důsledku zvýšení procházejícího světla pro daleko-červené (FR) (Taylorson &Borthwick, 1969 Thompson & Grime, 1983 Sattin et al.. 1994 Norsworthy 2004), který inhibuje klíčení různých druhů Amaranthus, jako je A. hybridus, A. palmeri, A. retroflexus a A. rudis (Taylorson & Borthwick, 1969 Gallagher & Cardina, 1998b, Hartzler a kol., 1999 Leon & Owen 2003 Jha a kol., 2008c). Stínování mateřské rostliny u A. retroflexus mělo za následek sníženou dormanci semen za krátkého dne (8 hodin světla) a zvýšenou dormanci semen za podmínek dlouhého dne (16 hodin světla) (Kigel et al., 1977). Washitani (1985) a Brainard a kol. (2005) také uvedli účinek zápoje listů na zvýšenou dormanci semen A. patulus. Procento klíčení semen A. powellii bylo o 50 % nižší u semen dozrávajících na rostlinách pěstovaných ve stínu než na otevřeném slunci (Brainard et al., 2005).

      Zpracování půdy je hlavním mechanismem vertikálního pohybu semen plevelů v půdě (Buhler et al., 1997, 2001). V systému bez orby se semena plevelů koncentrují v horních 5 cm půdního profilu oproti konvenčním systémům zpracování půdy (Cardina et al., 1991 Buhler, 1992 Clements et al., 1996), což umožňuje plevelům s malými semeny např. jako prasečí plevele snadněji vylézají z mělkých hloubek (Webb a kol., 1987 Buhler a kol., 1996 Oryokot a kol., 1997a Ghorbani a kol., 1999). Stimulace klíčení a následného vzcházení po zpracování půdy byla pravděpodobně způsobena zvýšenou aerací půdy, zlepšeným kontaktem půdy se semeny a zvýšenými teplotami půdy (Litch a Al-Kaisi 2005 Leon a Owen 2006 Norsworthy a Oliveira 2007). Vysoká redukce Amaranthus systémem zpracování půdy je sice slibná, ale není dostatečná. Kontrola přibližně 90 % není uspokojivá, protože při nízkých hustotách přežívající rostliny Amaranthus produkují více semen na rostlinu než při vysokých hustotách (Burki et al., 1997).

      Sečení také není účinnou možností pro kontrolu různých druhů Amaranthus, protože jakmile se posekají, odskočí a začnou růst vyčerpaně, produkuje životaschopné semeno a dokončí svůj životní cyklus, pokud se sečení neudržuje. Proto mohou být herbicidy účinnější možností kontroly těchto druhů než sečení.

      Herbicidy jsou nákladově efektivní a účinné nástroje pro kontrolu plevele v moderním zemědělství. 2,4-D (Szmedra, 1997), Aminocyklopyrachlor (DuPont, 2009), Aminopyralid (Burch a kol., 2005), Dicamba (Senseman a kol., 2007), Pendimethalin (Malefyt a Duke, 1984). široce používané herbicidy pro kontrolu širokolistých plevelů ve světě. Aplikace herbicidů od začátku do poloviny sezóny (začátek května až konec června) (Dieleman et al. 1996) s časným uzavřením koruny plodin by byla slibnou strategií pro řízení různých druhů Amaranthus (Jha et al., 2008a, 2008b). Steckel (2004) uvedl, že druhy Amaranthus v různých řádkových plodinách lze nejlépe zvládnout, když po předem aplikovaném herbicidu následuje postaplikovaný herbicid nebo když po postaplikovaném herbicidu následuje další postaplikovaný herbicid, který obsahuje zbytkový produkt. Ačkoli mnoho v současnosti označených herbicidů aplikovaných do půdy jako 2,4-D, Banvel[R] nebo Clarity[R] (dicamba), Cimarron[R] (metsulfiiron), Cimarron Max[R] (metsulfixron +2,4-D+ dicamba ), Distinct[R] (diflufenzopyr + dicamba), Grazon P + D[R] (picloram +2,4-D), Milestone[R] (aminopyralid) nebo ForeFront R&P[R] (aminopyralid +2,4-D ), Roundup[R] (glyfosát), Surmount[R] (picloram + fluroxypyr) a Weedmaster[R] (dicamba +2,4-D) poskytly dobrou kontrolu různých druhů Amaranthus, byly hlášeny potíže s kontrolou (Fritz & Hartwig, 1986 Fuerst a kol., 1986 Mayo a kol., 1995 Grichar, 1997 Steckel, 2004 Green a kol., 2006 Boyd, 2008). Při správném výběru herbicidu je možná 90% kontrola A. albus, A. palmeri, A. retroflexus a A. rudis (Sweat et al., 1998). Kromě toho může být nutné provést dvě až tři aplikace herbicidů, aby je bylo možné účinně kontrolovat po celou sezónu (Ferrell & Sellers, 2007).

      Rezistence vůči herbicidům u druhů Amaranthus

      Výhradní spoléhání se na herbicidy vedlo k vývoji rezistence k herbicidům u plevelů (Heap, 2014). V mnoha zemích se vyvinuly biotypy Amaranthus odolné vůči herbicidům (Barralis & Gasquez, 1987). Uvádí se, že alespoň jeden druh plevele Amaranthus je odolný vůči jedné nebo více skupinám herbicidů ve dvaceti devíti státech USA (Sellers et al., 2003). Přítomnost znaků tolerance vůči herbicidům vyvolává otázky, jak řešit problémy řízení na pěstitelské, okresní a regionální úrovni (Cardina et al., 1999). Vývoj rezistence vůči glyfosátu, celosvětově nejrozšířenějšímu herbicidu s účinnou širokospektrální kontrolou plevelů, je významným problémem, kterému čelí světové zemědělství (Powles, 2008 Webster & Sosnoskie, 2010).

      Ze Severní Ameriky, Evropy a Asie byly hlášeny biotypy A. blitum odolné vůči herbicidům, které si vyvinuly rezistenci vůči různým herbicidům včetně inhibitorů ALS, Atrazinu a Paraquatu (Itoh a kol., 1992 Manley a kol., 1996 Heap, 2014). A. palmeri si vyvinula rezistenci na několik různých herbicidů, včetně inhibitorů acetolaktátsyntázy (ALS), dinitroanilinu, glyfosátu, imidazolinonu, sulfonylmočoviny a triazinu (Gossett a kol., 1992 Horak & Peterson, 1995 Sprague a kol., Frant997 Peterson, 1999 a kol., 2001a Culpepper a kol., 2006 Steckel a kol., 2008 Vencill a kol., 2008 Wise a kol., 2009 Price a kol., 2011 Heap, 2014). Byly také popsány biotypy A. rudis a A. retroflexus s rezistencí vůči herbicidům inhibujícím glyfosát, triazin nebo acetolaktátsyntázu (Horak & Peterson, 1995 Peterson, 1999 Price et al, 2011). Před nedávným výskytem rezistence na glyfosát u A. palmeri (Culpepper et al., 2006 Mueller et al., 2006 York et al., 2007 Culpepper et al., 2008 Norsworthy et al. 2008 Steckel et al., 2008 Gaines ., 2010 Price a kol., 2011), glyfosát byl vysoce účinný při kontrole tohoto plevele (Scott a kol., 2002 Norsworthy, 2004, 2005 Bond a kol., 2006), což přispělo k rychlému přijetí sóji odolné vůči glyfosátu. a bavlna na jihu Spojených států. Průzkum mezi pěstiteli v Georgii odhalil, že přítomnost A. palmeri rezistentní na glyfosát na polích zvýšila náklady na řízení o 58 %, z 81 USD na ha21 na 129 USD za ha21 (Culpepper & Kichler, 2009).

      A. tuberculatus si vyvinuli rezistenci vůči pěti různým chemickým třídám herbicidů: inhibitory acetolaktát syntázy (ALS) (Horak & Peterson, 1995 Foes a kol., 1998 Tranel & Wright, 2002 Patzoldt & Tranel, 2007 Nordby a kol., 2010), 2010 glyfosát (Legleiter a Bradley 2008 Nandula et al. 2013), inhibitory p-hydroxyfenylpyruvát dioxygenázy (HPPD) (Hausman et al. 2011), inhibitory fotosystému II (PSII), nazývané také triaziny (Anderson et al., 1996) a Protoporphyrinogen inhibitory oxidázy (PPO) (Shoup et al., 2003), dále si některé jeho populace vyvinuly rezistenci vůči více třídám herbicidů (Tranel et al., 2004 Falk et al., 2005 Patzoldt et al., 2005 Mcmullan & Green, 2011 Bell a kol., 2013). Současně se zdá, že odolnost vůči ALS nemá žádné náklady na fitness v prostředích bez herbicidů u některých druhů Amaranthus (Sibony & Rubin, 2002, ale viz Tardif et al, 2006).

      Biologická kontrola druhů Amaranthus

      Nadměrné používání herbicidů vedlo k problémům, včetně kontaminace zdrojů povrchových a podzemních vod (Guzzella et al., 2006 Spalding et al., 2003) a různých rizik pro lidské zdraví (EPA, 2007). Rostoucí obavy veřejnosti z reziduí pesticidů v našich potravinách a životním prostředí a zvyšující se tlak veřejnosti na udržitelnější metody produkce plodin vedly ke vzrůstajícímu zájmu o integrované strategie kontroly plevele u druhů Amaranthus (Burki et al., 1997), založené na mechanickém fyzické nebo biologické kontroly. Četné plevelné druhy Amaranthus byly vybrány pro výzkum biologické kontroly v rámci akce COST (Evropská spolupráce v oblasti vědeckého a technického výzkumu) (Muller-Scharer, 1993).

      Různé druhy hmyzu, které jsou propagovány jako biologická kontrolní činidla pro různé druhy Amaranthus (jako A. caudatus, A. hybridus, A. retroflexus, A. spinosus, A. viridis), jsou: Disonycha glabrata (Garman, 1892 Vogt & Cordo, 1976 Balsbaugh a kol., 1981 Tisler, 1990), Chaetocnema tibialis (Cagan a kol., 2000), Cassida nigriventris a Coleophora versurella (Khan a kol., 1978), Hypolixus truncatidus (Napompeth), 19892, Juli, 19892, Juli Hypolixus nubilosus (Kolaib et al., 1986 Lopez et al., 2011 Torres et al., 2011 Kagali et al., 2013), Haplopeodes minutes (Spencer & Steyskal, 1986), Epicauta leoparda7, Melopardina (Spencer a Steyskal, 1986), Epicauta leopardina, Melopardina Spencer & Havranek, 1989), Pellucidus Vittula (Cagan et al., 2000) a Hepertogramma bipunctalis (Lopez et al., 2011 Kagali et al., 2013).

      Erwinia carotovora var. rhapontici (Kataryan, 1975 Mendoza & Rodriguez, 1990), Gliocladium virens (Howell & Stipanovie, 1984) jsou některé příklady bakterií, které lze použít jako biokontrolní činidla pro různé druhy Amaranthus. Slibné patogeny, které lze použít jako potenciální bioherbicid nebo mykoherbicid pro Amaranthus, zahrnují: Aposphaeria amaranthi (Mintz & Weidemann, 1992) Microsphaeropsis amaranthi (Ortiz Ribbing & Williams, 2006), Phomopsis amaranthicola2 & Ribbbbamps,Charuttern (061 Williams) alternata (Ghorbani et al., 2000).

      Alelopatie může být také užitečným prostředkem biologické kontroly plevele, zvláště když je integrována do systémů ochrany proti škůdcům, čímž se snižuje závislost na syntetických herbicidech. Nedávný screening inhibiční aktivity proti A. spinosus identifikoval několik rostlin s herbicidní aktivitou (Rizvi & Rizvi, 1992). Macharia a Peffiey (1995) popsali alelopatický účinek genotypů Allium fistidosum a A. cepa na růst rostlin a klíčení semen A. spinosus. Vodné extrakty pletiv některých rostlin jako Artemisia annua, Cirsium arvense, Fagopyrum esculentum, Helianthus annuus, Rumex crispus a Sorghum halepense snižuje klíčení A.retroflexus (Costea a kol., 2004 Haramoto & Gallandt, 2005). Tyto rostliny tak mohou působit jako činidla biologické kontroly.

      Potenciální střet zájmů mezi potřebou účinné biologické kontroly škodlivých druhů Amaranthus, aby se zabránilo velkým ztrátám na úrodě a snížení aplikace herbicidů v systémech udržitelného zemědělství na jedné straně a potenciální ekonomickou hodnotou určitých druhů Amaranthus jako plodin na straně druhé , je třeba projednat a vyřešit. Důležité je, že prostředky používané v inundativní biologické kontrole škodlivých druhů Amaranthus by neměly ohrozit plodinu Amaranthus (Burki et al., 1997).

      Vysoká nutriční hodnota semen Amaranthus, funkční potenciál, krátký životní cyklus, rychlý růst, adaptabilita na nepříznivé klimatické a půdní podmínky, tolerance k suchu a potravinářské využití celé rostliny je důvodem rostoucího zájmu výzkumu o tuto pseudoobilninu. Toto je potrava pro budoucí plodiny pro mnoho rozvojových zemí, zejména v oblastech Afriky a Asie náchylných k suchu. Rod Amaranthus se však skládá z některých obtížných invazních nebo škodlivých plevelů světa, o kterých je známo, že konkurují mnoha ekonomickým plodinám v různých částech světa, což vede k velkým ztrátám na výnosech. K výběru mezi dobrými a špatnými amaranty je proto zapotřebí rozsáhlý výzkum.

      Adefemi, O. S., O. A. Ibigbami & E. E. Awokunmi. 2012. Úroveň těžkých kovů v některých jedlých rostlinách shromážděných z vybraných skládek ve státě Ekiti v Nigérii. Global Advanced Research Journal of Environmental Science and Toxicology 1: 132-136.

      Adefila, E. O., C. T. Onwordi & I. A. Ogunvvande. 2010. Úroveň absorpce těžkých kovů zeleninou pěstovanou na skládce drůbežího trusu. Archives of Applied Science Research 2: 347-353.

      Adekunle, I. M., O. Olorundare & C. Nwange. 2009. Hodnocení hladin olova a denního příjmu ze zelené listové zeleniny jihozápadní Nigérie. Výživa a potravinářství 39: 413-422.

      Adewuyi, G. O., F. A. Davvodu & N. N. Jibiri. 2010. Studie úrovní koncentrace těžkých kovů v zelenině (Amaranthus caudattts) pěstované na skládkách v Lagos Metropolis, Nigérie. Pacific Journal of Science and Technology 11: 616-620.

      Aguyoh, J. N. & J. B. Masiunas. 2003. Interference prasečího (Amaranthus retroflexus) s fazolemi. Weed Science 51: 202-207.

      Akubugwo, E. I., A. Obasi, G. C. Chinyere, E. Eze, O. Nwokeoji & E. A. Ugbogu. 2012. Fytoakumulační účinky Amaranthus hybridus L. pěstované na skládkách odpadu buwaya v Chikunu v Nigérii na těžké kovy. Journal of Biodiversity and Environmental Sciences 2: 10-17.

      Alam, S. M., S. A. Ala, A. R. Azmi, M. A. Khan & R. Ansari. 2001. Alelopatie a její role v zemědělství. Journal of Biological Sciences 1: 308-315.

      Al-Khatib, K. 1995. Regulace plevele u pšenice. Washington State University Cooperative Extension, s. 244-364.

      Aim, D. M., M. E. Mcgiffcn & J. D. Hesketh. 1991. Fenologie plevelů. In: Hodges T, ed. Předpovídá fonologii plodin. Boca Raton: CRC Press 191-218.

      --, S. M. Khan, S. M. Mujtaba & A. Shereen. 2002. Vliv vodného extraktu z listů jehňat a slanosti NaCl na klíčivost, růst a obsah živin pšenice. Acta Physiologiae Plantarum 24: 359-364.

      Altieri, M. A. & J. D. Doll. 1978. Potenciál alelopatie jako nástroje ochrany proti plevelům na polích plodin. PANS 24: 495-502.

      Al-Turki, T. A., S. A. Fllfilan & S. F. Mehmood. 2000. Cytologická studie kvetoucích rostlin ze Saúdské Arábie. Willdenowia 30: 339-358.

      Amini, R., S. Ghanepour & F. Movahedpour. 2013. Morfofyziologické a fenologické změny vyvolané alelopatickými účinky hladkého amarantu u různých druhů suchých bobů. International Journal of Agriculture and Crop Sciences 5: 120-124.

      Anaya, L., L. Ramos, R. H. Cruz, J. G. Fernandez & V. Nava. 1987. Pohledy na alelopatii v mexických tradičních agroekosystémech: Případová studie v Taxcala. Journal of Chemical Ecology 13: 2083-2101.

      Anderson, R. L. & D. C. Nielsen. 1996. Vzorec vzcházení pěti plevelů v centrálních velkých pláních. Weed Technology 10: 744-749.

      Anderson, D. D., F. W. Roeth & A. R. Martin. 1996. Výskyt a kontrola triazinkorezistentního konopí obecného (Amaranthus rudis) v polní kukuřici (Zea mays). Weed Technology 10: 570-575.

      Atayese, M. O., A. I. Eigbadon, K. A. Oluwa & J. K. Adesodunl. 2009. Kontaminace Amaranthus těžkými kovy pěstovaných podél hlavních dálnic v Lagosu v Nigérii. African Crop Science Journal 16: 225-235.

      Balsbaugh, E. U., R. D. Frye Jr., C. G. Scholl & A. W. Anderson. 1981. Hmyz pro hubení plevele: stav v Severní Dakotě. Farmářský výzkum Severní Dakoty 39: 3-7.

      Baquar, S. R. & O. O. Olusi. 1988. Cytomorfologické a fylogenetické studie rodu Amaranthus z Nigérie. Kromosomo 51: 1665-1674.

      Barralis, G. & J. Gasquez. 1987. Výzkumy plevelů odolných vůči herbicidům. Newsletter Evropské společnosti pro výzkum plevele 38: 5-10.

      Baskin, I. J. & C. C. Baskin. 1977. Role teploty v ekologii klíčení tří letních jednoletých plevelů. Occologia 30: 377-382.

      Baskin, J. M. & C. C. Baskin. 1985a. Sezónní změny v odpovědích na klíčení pohřbených semen čarodějnice (Panicum capillare). Weed Science 34: 22-24.

      --&--. 1985b. Roční dormační cyklus v zahrabaných semenech plevele: kontinuum. Bioscience 35: 492-498.

      --&--. 1987. Teplotní požadavky pro dozrání v pohřbených semenech čtyř letních jednoletých plevelů. Weed Research 27: 385-389.

      --&--. 1990. Role světla a střídání teplot na klíčení semen Polygonum aviculare exhumována v různých datech. Weed Research 30: 397-102.

      --&--. 1998. Semena: Ekologie, biogeografie a vývoj dormance a klíčení. San Diego: Academic Press s. 27-200.

      Batlla, D., B. C. Kruk & R. L. Benech-Arnold. 2000. Velmi časná detekce přítomnosti zápoje semeny prostřednictvím vnímání jemných modifikací v signálech R:FR. Funkční ekologie 14: 195-202.

      Becker, R., E. L. Wheeler, K. Lorenz, A. E. Stafford, O. K. Grosjean, A. A. Betschart & R. M. Saunders. 1981. Studie složení amarantového zrna. Journal of Food Science 46: 1175-1180.

      Behera, B. & S. N. Patnaik. 1974. Cytotaxonomické studie v rodině amaranthaceac. Cytologia 39: 121-131.

      --&--. 1977. Analýza genomu Amaranthus dubius Mart, ex Thell. studiem hybridů A. spinosus x A. dubius. Proceedings of Indian Science Congress Association 64: 144.

      --&--. 1982. Analýza genomu Amaranthus dubius Mart, ex Thell. studiem hybridů Amaranthus spinosus x A. dubius. Cytologia 47: 379-389.

      Bell, M. S., A. G. Hager & P. ​​J. Tranel. 2013. Mnohonásobná rezistence vůči herbicidům ze čtyř skupin míst účinku u konopí vodního (Amaranthus tubereulatus). Weed Science 61: 460-468.

      Benech-Arnold, R.L., C.M. Ghersa, R.A. Sanchez & P. ​​Insausti. 1990. Vliv teploty na uvolňování dormance a rychlost klíčení u Sorghum halepense (L.) Pers. semena: kvantitativní analýza. Weed Research 30: 81-89.

      --, R. A. Sanchez, F. Forcella, B. C. Kruk & C. M. Ghersa. 2000. Environmentální kontrola dormance v bankách semen plevele v půdě. Field Crops Research 67: 105-122.

      Bensch, C. N., M. J. Horak & D. Peterson. 2003. Interference prasečího (Amaranthus retroflexus), amarantu palmového (A. palmeri) a konopí obecného (A. rudis) v sóji. Weed Science 51: 37-43.

      Benvenuti, S. 2003. Zapojení textury půdy do klíčení a vzcházení pohřbených semen plevelů. Agronomy Journal 95:191-198.

      --& M. Macchia. 1997. Ekofyziologie klíčení klíšťat obecných (Bidens tripartite) ovlivněných světlem a kyslíkem. Weed Science 45: 696-700.

      --&--. 1998. Fytochromem zprostředkovaná kontrola klíčení semen Datura stramonium L. po zahrabání semen. Weed Research 38: 199-206.

      --, M. Macchia & S. Miele. 2001. Kvantitativní analýza vzcházení semenáčků ze zahrabaných semen plevelů s rostoucí hloubkou půdy. Weed Science 49: 528-535.

      Bewley, J. D. & M. Black. 1994. Semena: fyziologie vývoje a klíčení. Plénum. Berlín.

      Bhowmik P. C. 1997. Biologie plevele: význam pro management plevele. Weed Science 45: 349-356.

      --& J. D. Doll. 1980. Terénní studie o alelopatických účincích plevelů a rostlinných zbytků. In Proceedings North Central Weed Control Conference 35: 82-83.

      --&--. 1982. Reakce kukuřice a sóji na alelopatické účinky plevelů a zbytků plodin. Agronomický časopis 74: 601-606.

      --&--. 1983. Analýza růstu reakce kukuřice a čiroku na alelopatické účinky zbytků plevele při různých teplotách a hustotách fotosyntetického toku fotonů. Journal of Chemical Ecology 9: 1263-1280.

      --&--. 1984. Alelopatický účinek zbytků jednoletých plevelů na růst a příjem živin kukuřice a sóji. Agronomy Journal 76: 383-388.

      Bibbey, R. 0,1935. Vliv prostředí na geninaci semen plevelů. Scientia Agricola 16:141-150.

      Bigaliev, A., K. Boguspaev & E. Znanburshin. 2003. Fytoremediační potenciál Amaranthus sp. pro půdu kontaminovanou těžkými kovy na území produkujícím ropu. 10. výroční mezinárodní konference o životním prostředí ropy. Houston, al-Farabi Kazach.

      Bonasora, M. G., L. Poggio & E. J. Greizerstein. 2013. Cytogenetické studie u čtyř kultivovaných druhů Amaranthus (Amaranthaceae). Srovnávací cytogenetika 7: 53.

      Bond, J. A., L. R. Oliver & D. O. Stephenson. 2006. Reakce přistoupení amarantu palmového (Amaranthus palmeri) na glyfosát, fomcsafcn a pyrithiobac. Weed Technology 20: 885-892.

      Bouwmeester, H.J. & C.M. Karssen. 1992. Dvojí role teploty v regulaci sezónních změn v dormanci a klíčení semen Polygonum persicaria L. Oecologia 90: 88-94.

      Boyd, J. 2008. Regulace plevele na pastvinách a keřů. University of Arkansas.

      Bradow, J. M. & W. J. Connick. 1987. Alelochemikálie amarantu palmového (Amaranthus palmeri S. Wats.). Journal of Chemical Ecology 13: 185-202.

      --&--. 1988. Inhibice klíčení semen těkavými alkoholy a jinými sloučeninami spojenými se zbytky Amaranthus palmeri. Journal of Chemical Ecology 14: 1633-1648.

      Brainard, D. C., R. R. Bellinder & A. DiTommaso. 2005. Účinky stínu zápoje na morfologii, fenologii a vlastnosti semen amarantu Powella (Amaranthus powelli). Weed Science 53:175-186.

      Breene, W. M. 1991. Potravinové využití obilného amarantu. Cereal Foods World 36: 426-430.

      Brenner, D. M., D. D. Baltensperger, P. A. Kulakow, J. W. Lehmann, R. L. Myers, M. M. Slabbert & B. B. Sleugh. 2000. Genetické zdroje a chov Amaranthus. Plant Breeding Reviews 19: 227-285.

      Buchanan, G. A., R. H. Crowley, J. E. Street & J. A. McGuire. 1980. Konkurence srpkovce (Cassia obtusifolia) a prasečího (Amaranthus retroflexus) s bavlníkem (Gossypium hirsutum). Weed Science 28: 258-262.

      Budin, J. T., W. M. Breen & D. H. Patnum. 1996. Některé kompoziční vlastnosti semen a olejů osmi druhů Amaranthus. Journal of the American Oil Chemists' Society 73: 475-481.

      Buhler, D. D. 1992. Dynamika populace a regulace jednoletých plevelů v kukuřici (Zea mays) ovlivněná zpracováním půdy. Weed Science 40: 241-248.

      --, T. C. Mester & K. A. Kohler. 1996. Vliv kukuřičných zbytků a zpracování půdy na vzejití Setaria faberi, Abutilon theophrasti, Amaranthus retroflexus a Chenopodium album. Weed Research 36: 153-165.

      --, R. G. Hartzler & F. Forcella. 1997. Důsledky dynamiky sccdbank plevelů na management plevele. Weed Science 45: 329-336.

      --, K. A. Kohler & R. L. Thompson. 2001. Dynamika banky semen plevele během pětiletého střídání plodin. Technologie plevele 15: 170-176.

      Burch, P., R. Masters, E. S. Hagood, K. Bradley, W. W. Witt, K. Moore & J. Breuninger. 2005. Aminopyralid: Nový herbicid pro integrované programy renovace.

      Burke, I. C., M. Schroeder, W. E. Thomas & J. W. Wilcut. 2007. Rušení amarantu palmového a produkce semen v arašídech. Weed Technology 21: 367-371.

      Burki, H. M., D. Schroeder, J. Lawrie, L. Cagan, M. Vrablová, M. E. Aydam, F. Szentkiralyi, R. Ghorbani, B. Jiittersonke & H. U. Ammon. 1997. Biologická kontrola prasečích (Amaranthus retroflexus L., A. Powellii S. Watson a A. bouchonii Thell.) fytofágním hmyzem, houbovými patogeny a managementem plodin Integrated Pest Management Reviews 2: 51-59.

      Burnside, O. C., C. R. Fernster, L. L. Evertts & R. F. Mumm. 1981. Klíčení exhumovaného semene plevele v Nebrasce. Weed Science 29: 577-586.

      --, R. G. Wilson, S. Weisberg & K. G. Hubbard. 1996. Životnost semen 41 druhů plevelů pohřbených 17 let ve východní a západní Nebrasce. Weed Science 44: 74-86.

      Cadman, C. S. C., P. E. Toorop, H. W. M. Hilhorst & W. E. Finch-Savage. 2006. Profily genové exprese semen Arabidopsis cvi během cyklu dormance naznačují společný základní mechanismus kontroly dormance. The Plant Journal 46: 805-822.

      Cagan, L., M. Vráblová & P. ​​Tóth. 2000. Blechovití (Chrysomelidae: Alticinae) druhy vyskytující se na Amaranthus spp. na Slovensku. Journal of Central European Agriculture 1: 14-25.

      Cardina, J., E. Regnier & K. Harrison. 1991. Dlouhodobé účinky zpracování půdy na semenné banky ve třech půdách v Ohiu. Weed Science 39: 186-194.

      --, T. M. Webster, C. P. Herms & E. E. Regnier. 1999. Vývoj plevele IPM: Úrovně integrace pro management plevele. Časopis rostlinné výroby 2: 239-267.

      --, C. P. Herms & D. J. Doohan. 2002. Účinky systému střídání plodin a zpracování půdy na semenné banky plevele. Weed Science 50: 448-460.

      Castelano-Sousa, V. M. & J. Amaya-Farfan. 2012. Stav znalostí o zrnu amarantu: komplexní přehled. Journal of Food Science 77: 93-104.

      Castor, R. D., A. A. M. Lammeren, S. P. C. Groot, G. Bino & W. M. Hilhorest. 2000. Buněčné dělení a následná protruze radikálů v semenech rajčat jsou inhibovány osmotickým stresem, ale syntéza DNA a tvorba mikrotubulárních cytostatik nikoli. Plant Physiology 122: 327-335.

      Chakravortv, A. & P. ​​D. Ghosh. 2012. Fenologie některých širokolistých kharifových plevelů aluvické zóny Západního Bengálska. International Journal of Scientific and Research Publications 2.

      Chaniago, I., A. Taji & R. Jessop. 2006. Interference plevele v sóji (Glycine max). Australská společnost pro agronomii. Sborník příspěvků z australské agronomické konference.

      Charudattan, R. 1994. Zpráva o stavu University of Florida, oddělení rostlinné patologie, Gainesville, FL, USA. International Biohcrbicidc Group IBG News 3: 8-9.

      Chauhan, B. S. & D. E. Johnson. 2009. Ekologie klíčení amarantu ostnitého (Amaranthus spinosus) a amarantu štíhlého (A. viridis): problematické plevele přímosemenné rýže. Weed Science 57: 379-385.

      Chepil, W. S. 1946. Klíčení semen plevelů: 1. Dlouhověkost, periodicita klíčení a vitalita semen v kultivované půdě. Vědecké zemědělství 26: 307-346.

      Chikkalingaiah, G. E. & M. Mahadevappa. 1998. Vliv různých druhů rostlin a rostlinných výluhů na plevel Parthenium hysterophorus L.. Crop Research 15: 106-164.

      Chinmayee, M. D., B. Mahesh, S. Pradesh, I. Mini & T. S. Swapna. 2012. Hodnocení fytormediačního potenciálu invazního plevele Amaranthus spinosus L. Applied Biochemistry and Biotechnology 167: 1550-1559.

      Clements, D.R., D.L. Benoit, S.D. Murphy & C.J. Swanton. 1996. Účinky zpracování půdy na návrat semen plevele a složení semenné banky. Weed Science 44: 314-322.

      Conforti, F., G. Statti, M. R. Loizzo, G. Sacchetti, F. Poli & F. Menichini. 2005. In vitro antioxidační účinek a inhibice a-amylázy dvou odrůd semen Amaranthus caudatus. Biological and Pharmaceutical Bulletin 28: 1098-1102.

      Connick, W. J., J. M. Bradow, M. G. Legendre, S. L. Vail & R. M. Menges. 1987. Identifikace těkavých alelochemikálií z Amaranthus palmeri S. Wats. Journal of Chemical Ecology 13: 463-472.

      Costa, M. & D. DeMason. 2001. Morfologie a anatomie stonku u Amaranthus L. (Amaranthaccae) Taxonomický význam. Journal of the Torrey Botanical Society 128: 254-281.

      --& F. J. Tardif. 2003. Biologie kanadských plevelů. 126. Amaranthus albus L., A. blitoides S. Watson a A. blitum L. Canadian Journal of Plant Science 83: 1039-1066.

      --, A. Sanders & G. Waines. 2001. Předběžné výsledky k revizi komplexu Amaranthus hybridus (Amaranthaccae). SIDA 19: 931-974.

      --, S. E. Weaver & F. J. Tardif. 2004. Biologie kanadských plevelů. 130. Amaranthus retroflexus L., A. powellii S. Watson a A. hybridus L. Canadian Journal of Plant Science 84: 631-668.

      Covas, G. & J. H. Hunziker. 1954. Estudies cariologicos en. Antofitas. Revista Invest Zemědělství 8: 249-253.

      --& B. Schnack. 1946. Numero dc cromosomas en antofitas de la region de Cuyo (Republica Argentina). Revista Argent. Agron 13: 153-166.

      Cowan, P., S. E. Weaver & C. J. Swanton. 1998. Interference mezi prasečím (Amaranthus spp.), bělokorou trávou (Echinochloa crus-galli) a sójou (Glycine max). Weed Science 46: 533-539.

      Cristaudo, A., F. Cresta, F. Luciani & A. Restuccia. 2007. Vliv období po sklizni a faktorů prostředí na dormanci semen druhů Amaranthus. Weed Research 47: 327-334.

      Culpepper, A. S. & J. M. Kichler. 2009. Herbicidní programy University of Georgia pro kontrolu amarantu palmového odolného vůči glyfosátu v bavlně z roku 2009. University of Georgia Colige of Agricultural and Environmental Sciences, Circular, 924 s. 2.

      Culpepper, A. S., T. L. Grey, W. K. Vencill, J. M. Kichler, T. M. Webster, S. M. Brown & A. C. York. 2006. Glyfosát odolný amarant (Amaranthus palmeri) potvrzen v Gruzii. Weed Science 54: 620-626.

      --, J. R. Whitaker, A. W. MacRae & A. C. York. 2008. Weed science: Distribuce amarantu palmového (Amaranthus palmeri) odolného vůči glyfosátu v Georgii a Severní Karolíně v letech 2005 a 2006. Journal of Cotton Science 12: 306-310.

      Das, S. 2016. Amaranty: Úroda velké vyhlídky. In Amaranthus: A Promising Crop of Future (s. 13-48). Springer Singapur.

      Datta, S. C. & A. K. Bandyopadhayay. 1981. Alelopatické vlivy tří plevelů na dvě plodiny. In: I Asian Pacific Weed Science Society Confcrcncc. APWSS: Tokio, s. 391-399.

      Der Marderosian, A. D., J. Beutler, W. Pfendner, J. Chambers, R. Yoder, E. Weinsteiger & J. Senft.

      1980. Obsah dusičnanů a oxalátů rostlinného amarantu. In Proceedings of the Second Amaranth Conference s. 31. Rodale Press. Emauzy. PA.

      Dieleman, A., A. S. Hamill, S. F. Weise & C. J. Swanton. 1995. Empirické modely interference vepřovice (Amaranthus spp.) v sóji (Glycine max). Weed Science 3: 612-618.

      --,--, G. C. Fox & C. J. Swanton. 1996. Rozhodovací pravidla pro postemergentní kontrolu prasečího (Amaranthus spp.) v sóji (Glycine max).Weed Science 44: 126-132.

      --, D. A. Mortensen, D. D. Buhler & R. B. Ferguson. 2000. Identifikace asociací mezi vlastnostmi lokality a četností druhů plevelů. II. Generování hypotéz. Weed Science 48: 576-587.

      Dillon, T.L., E.L. Baldwin & C.M. Becton. 1989. Kontrola amarantu palmového v písčité půdě v severovýchodním Arkansasu. Proceedings of the Southern Weed Science Society 42: 113.

      Dorling, K. 2008. RHS AZ Encyklopedie zahradních rostlin. Spojené království 1136.

      Doroszeweski, A. 2001. Přírodní pro červené ozáření a perzistenci semen v půdě. In: Ellis, R. H. a Black, M. (eds), Základní a aplikované aspekty biologie semen. Kluwer Academic Publishers, s. 297-302.

      Dos Santos, C. C., D. F. De Oliviera, L. W. R. Alves & D. A. S. De Furtado. 2004. Vliv organických extraktů spojených s povrchově aktivní látkou Tween 80 na klíčení semen a růst sazenic salátu. Ciencia e Agrotecnologia 28: 296-299.

      Dowler, C. C. 1995. Průzkum plevelů-jižní státy: podsekce širokopásmových plodin. Southern Weed Science Society 48: 298-302.

      Downtown, W. J. S. 1973. Amaranthus edulis: amarant s vysokým obsahem lysinu. Světové plodiny 25: 20-21.

      Drew, M. C. 1990. Snímání půdního kyslíku. Plant Cell Environment 13: 681-693.

      Ochrana plodin DuPont. 2009. Technický bulletin DPX-MAT 28 Hcrbicidc.

      Early, D. K. 1977. Pěstování a využití amarantu v současném Mexiku. In: Sborník příspěvků z prvního semináře amarantu: 39. Rodale Press: 39-60.

      Early, D. 1992. Renesance amarantu, s. 15-33. V N. Foster a L. S. Cordell (eds.). Chiles k čokoládě: Potraviny, které Amerika dala světu. University of Arizona Press, Tucson.

      Egley, G. H. 1989. Některé účinky půdy nitratc-trcatcd na citlivost semen zakopaných semen prasečího (A. retroflexus L.) na ethylen, teplotu, světlo a oxid uhličitý. Plant Cell and Environment 12: 581-588.

      Eliasson, U. H. 1988. Květinová morfologie a taxonomické vztahy mezi rody Amaranthaceae v Novém světě a na Havajských ostrovech. Botanical Journal of the Linnaean Society 96: 235-283.

      Elmore, C. L. 1996. Znovuzavedení integrovaného managementu plevele. Weed Science 44: 409-112,

      EPA (Agentura pro ochranu životního prostředí). 2007. Výzkum se zabývá potenciálními riziky atrazinu a příbuzných pesticidů. Úřad pro výzkum a vývoj.

      Espitia-Rangel, E. 1994. Šlechtění amarantu obilného. Amaranth: biologie, chemie a technologie. CRC press, Boca Raton, USA 23-38.

      Evans, C. R. 1922. Vliv teploty na klíčení Amaranthus retroflexus. Botanický list 73: 213-225.

      Faccini, D. & J. I. Vitta. 2005. Charakteristiky klíčení A. prettynsis ovlivněné datem produkce semen a délkou pohřbení. Weed Research 45: 371-378.

      Falk, J. S., D. E. Slioup, K. Al-Khatib & D. E. Peterson. 2005. Průzkum reakce konopí obecného (Amaranthus rudis) na herbicidy inhibující protox a ALS v severovýchodním Kansasu. Weed Technology 19: 838-846.

      FAO. 1973. Potřeba energie a bílkovin. In: Řada zpráv FAO o výživě setkání (č. 52).

      Farvin, K. S., R. Anandan, S. H. S. Kumar, K. S. Shiny, S. Mathew, T. V. Sankar & P. ​​V. Nair. 2006. Kardioprotektivní účinek squalcne na lipidový profil u isoprenalinem indukovaného infarktu myokardu u potkanů. Journal of Medicinal Food 9: 531-536.

      Fernando, T. & G. Bean. 1984. Mastné kyseliny a steroly z Amaranthus tricolor L. Food Chemistry 15:233-237.

      Ferrell, J. & B. Sellers. 2007. Regulace amarantu ostnitého na pastvinách. University of Florida.

      Fischer, N. H. & L. Quijano. 1985. Alelopatická agens z běžných plevelů: Amaranthus palmeri. Ambrosia artemisiijolia a příbuzné plevele. V sérii ACS Symposium American Chemical Society.

      Flint, E. P. & D. T. Patterson. 1983. Interference a teplotní účinky na růst sóji a souvisejících plevelů [C3] a [C4]. Weed Science 31: 191-195.

      Foes, M. J., P. J. Tranel, L. M. Wax & E. W. Stoller. 1998. Biotyp konopí obecného (Amaranthus rudis) odolného vůči triazinům a herbicidům ALS. Weed Science 46: 514-520.

      Forcella, F., R. G. Wilson & J. Dekker. 1997. Vznik banky semen plevele v kukuřičném pásu. Weed Science 45:67-76.

      Fortin, M. C. & F. J. Pierce. 1990. Vývoj a růstové účinky rostlinných zbytků na kom. Agronomický časopis 82: 710-715.

      Franssen, A. S., D. Z. Skinner, K. Al-Khatib & M. J. Horak. 2001a. Morfologické rozdíly pylu u druhů Amaranthus a mezidruhových hybridů. Weed Science 49:732-737.

      --,--,--,--& P. A. Kulakow. 2001b. Mezidruhová hybridizace a genový tok ALS rezistence u druhů Amaranthus. Weed Science 49: 598-606.

      Fritz, T. J. & N. L. Hartwig. 1986. Hubení amarantu ostnitého na pastvinách. Proceedings of the Northeastern Weed Science Society 40: 20-23.

      Fuerst, E.P., M. Barrett & D. Penner. 1986. Kontrola triazinu odolných jehňat obecných (Chenopodium album) a dvou druhů prasečích (Amaranthus spp.) v kukuřici (Zea mays). Weed Science 34: 440-443.

      Fuller, H. J. 1949. Fotoperiodické odezvy Chenopodium quinoa Willd. a Amaranthus caudatus L. American Journal of Botany 36:175-180.

      Gaines, T. A., W. Zhang, D. Wang, B. Bukun, S. T. Chisholm & D. L. Shaner. 2010. Amplifikace genu uděluje rezistenci na glyfosát u Amaranthus palmeri. Proceedings of the National Academy of Sciences 107: 1029-1034.

      --, S. M. Ward, B. Bukun, C. Preston, J. E. Leach & P. ​​Westra. 2012. Mezidruhová hybridizace přenáší dříve neznámý mechanismus rezistence na glyfosát u druhů Amaranthus. Evoluční aplikace. Blackwell Publishing Ltd. str. 529-538.

      Gallagher, R.S. & J. Cardina. 1997. Prahové hodnoty půdní vody pro fotoindukci klíčení prasečích plevelů. Weed Science 45: 414-418.

      --&--. 1998a. Klíčení Amaranthus I zprostředkované fytochromem: Vliv zahrabávání semen a teploty klíčení. Weed Science 46: 48-52.

      --&--. 1998b. Klíčení Amaranthus II zprostředkované fytochromem: Vývoj velmi nízké citlivosti na fluence. Weed Science 46: 53-58.

      Garcia, L.A., M.A. Alfaro & R. Bressani. 1987. Stravitelnost a nutriční hodnota ropy ze tří druhů amarantů. Journal of the American Oil Chemists' Society 64: 371-375.

      Garman, H. 1892. Blechovka prasečí. Druhý. Ann. Rep. Kentucky Agr. Exp. Sta. 1889: 27-30.

      Ghersa, C. M. & J. S. Holt. 1995. Použití fenologické predikce v péči o plevel: přehled. Weed Research 35: 461-470.

      --, R. L. Benech-Arnold & M. A. Martinez-Ghersa. 1992. Role kolísání teplot při klíčení a usazování Sorghum halepense. Regulace klíčení ve větších hloubkách. Funkční ekologie 6: 460-468.

      Ghorbani, R., W. Seel & C. Leifert. 1999. Účinky faktorů prostředí na klíčení a vzcházení Amaranthus retroflexus. Weed Science 47: 505-510.

      --,--, A. Litterick & C. Leifert. 2000. Hodnocení Alternaria alternativní pro biologickou kontrolu

      Amaranthus retroflexus. Weed Science 48: 474-480.

      Ghosh, B. K. & N. K. Bruin. 1997. Dormance a životaschopnost semen amarantu obilného. Indian Journal of Plant Physiology 2: 15-17.

      Gossett, B. J., E. C. Murdock & J. E. Toler. 1992. Rezistence amarantu palmového (Amaranthus palmeri) vůči herbicidům dinitroanilinu. Weed Technology 6: 587-591.

      Grant, W. F. 1959a. Cytogenetické studie u Amaranthus. II. Přirozená mezidruhová hybridizace mezi A. dubius a A. spinosus. Canadian Journal of Botany 37: 1063-1070.

      -. 1959b. Cytogenetické studie u Amaranthus. III. Počty chromozomů a fylogenetické aspekty. Canadian Journal of Genetics and Cytology 1: 313-328.

      Green, J. D., W. W. Witt & J. R. Martin. 2006. Likvidace plevelů na travnatých pastvinách, senácích a dalších místech zemědělských usedlostí. University of Kentucky. Ext. Hospoda. AGR-172.

      Greizerstein, E. J. & L. Poggio. 1992. Cytogenetické studie u šesti interspecifických hybridů Amaranthus (Amaranthaceae). Darwiniana 31: 159-165.

      -. 1995. Meiotické studie spontánních hybridů Amaranthus: analýza genomu. Šlechtění rostlin 114: 448-150.

      --, C. A. Naranjo & L. Poggio. 1997. Karyologické studie u pěti divokých druhů Amaranthus. Cytologia 62: 115-120.

      Grichar, W. J. 1997. Kontrola amarantu palmového (Amaranthus palmeri) v arašídu (Arachis hypogaea) postemergentními herbicidy. Weed Technology 11: 739-743.

      Grubben, G. J. H. & D. H. van Sloten. 1981. Genetické zdroje amarantů. Intl. Rada pro rostlinné genetické zdroje, potraviny a zemědělství. Org.. Řím.

      Gudu, S. & V. K. Gupta. 1988. Samčí sterilita u amarantu zrna (Amaranthus hypochondriacus ex-Nepal) odrůdy Jumla. Eufytika 37: 23-26.

      Guo, P. & K. Al-Khatib. 2003. Teplotní vlivy na klíčení a růst prasečího rodu (Amaranthus retroflexus). amarant palmový (Amaranthus palmeri) a konopí obecná (A. rudis). Weed Science 51: 869-875.

      Gutterman, Y. & G. Genotypic. 1997. Fenotypové a oportunní strategie klíčení některých běžných pouštních letniček ve srovnání s jinými strategiemi šíření semen a klíčení In: Ellis. R. H. a Black, M. (eds), Základní a aplikované aspekty biologie semen. Kluwer Academic Publishers, s. 611-622.

      --, F. Corbineau & D. Přijďte. 1992. Vzájemné vlivy teploty, světla a kyslíku na klíčení semen Amaranthus caudatus L.. Weed Research 32: 111 117.

      Guzzella, L., F. Pozzoni & G. Giuliano. 2006. Herbicidní kontaminace povrchových podzemních vod v severní Itálii. Environmental Pollution 142: 344-353.

      Habib, S.A. & H.L. Morton. 1987. Kombinovaný účinek teploty a vodního potenciálu na klíčení semen vedlejšího ovsa grama a redroot vepřovice. Iraqi Journal of Agricultural Science 5: 15-24.

      Hanf, M. 1984. Ackerunkra "titer Europas mit ihren Keimlingen, s. 166-70. Ludwigshafcn: BASFAG.

      Haramoto, E. R. & E. R. Gallandt. 2005. Krycí plodina Brassica: II. Účinky na růst a interferenci fazole zelené (Phaseolus vulgaris) a prasečáku (Amaranthus retroflexus). Weed Science 53:702-708.

      Hartzler, R.G., D.G. Buhler & D.E. Stoltenberg. 1999. Charakteristiky vzcházení čtyř jednoletých druhů plevelů. Weed Science 47: 578-584.

      --, B. A. Battles & D. Nordby. 2004. Vliv data vzniku konopí obecného (Amaranthus rudis) na růst a plodnost sóji. Weed Science 52: 242-245.

      Hauptli, H. & S. Jain. 1985. Genetická variace v rychlosti křížení a korelované květinové znaky v populaci amarantu obilného (Amaranthus cruentus L.). Genetica 66: 21-27.

      Hausman, N. E., S. Singh, P. J. Tranel, D. E. Riechers, S. S. Kaundun, N. D. Polge, D. A. Thomas & A. G. Hager. 2011. Rezistence k herbicidům inhibujícím HPPD v populaci vodního konopí (Amaranthus tuberculatus) z Illinois, Spojené státy americké. Pest Management Science 67: 258-261.

      Heap, I. 2014. Mezinárodní průzkum plevelů odolných vůči herbicidům. In Western Society of Weed Science (USA). Webová stránka http://www.weedscicncc.org/in.asp (Accessed Octobcr 2, 2014).

      Heidarian, H., M. R. Hadi, H. S. Mahmoodabadi & M. N. Kalateh. 2012. Konkurenční účinky prasečníku červeného (Amaranthus retroflexus) na tři kultivary slunečnice (Helianthus annus). International Journal of Agronomy and Plant Production 3: 84-88.

      Heiser Jr., C. B. & T. W. Whitaker. 1948. Počet chromozomů, polyploidie a růstový habitus u kalifornských plevelů. American Journal of Botany 179-186.

      Hendrick, L. W., W. F. Meggitt & D. Penner. 1974. Základ pro selektivitu fenmedifamu a dcsmcdiphamu na divokou hořčici, prasečák a cukrovou řepu. Weed Science 22: 179-184.

      Hendricks, S. B., V. K. Toole & H. A. Borthwick. 1968. Protichůdné působení světla při klíčení semen Poa pratensis a Amaranthus arenicola. Fyziologie rostlin 43: 2023-2028.

      Hicks, S. K., P. H. Munger, J. R. Abernathy & C. W. Wendt. 1986. Účinek amarantových alelopatických sloučenin na plodiny. In Proceedings of Southern Weed Science Society 411.

      Holm, R. E. 1972. Těkavé metabolity řídící klíčení v zahrabaných semenech plevelů. Plant Physiology 50: 293-297.

      --& M. R. Miller. 1972. Reakce klíčení semen plevele na chemické a fyzikální ošetření. Weed Science 20: 150-153.

      Holm, L.G., D.L. Plunkett, J.V. Pancho & J.P. Herberger. 1977. Nejhorší světová distribuce plevele a biologie. University Press of Hawaii 606.

      --, J. V. Pancho, J. P. Herberger & D. L. Plucknett. 1979. Geografický atlas světových plevelů. New York, USA: John Wiley and Sons.

      Horak, M. J. 1997. Měnící se povaha palmerového amarantu: studie pohody. Proceedings of the North Central Weed Science Society 52: 161.

      --& T. M. Loughin. 2000. Analýza růstu čtyř druhů Amaranthus. Weed Science 48: 347-355.

      --& D. E. Peterson. 1995. Biotypy amarantu palmového (Amaranthus palmeri) a konopí obecného (Amaranthus rudis) jsou odolné vůči imazetapyru a thifensulfuronu. Weed Technology 9: 192-195.

      Howell, C. R. & R. D. Stipanovic. 1984. Fytotoxicita pro kulturní rostliny a herbicidní účinky viridiolu produkovaného Gliocladium virens na plevele. Phytopathology 74: 1346-1349.

      Huang, J. Z., A. Shrestha, M. Tollenaar, W. Deen, H. Rahimian & C. J. Swanton. 2000. Vliv fotoperiody na fenologický vývoj prasečníka obecného (Amaranthus retroflexus L.). Canadian Journal of Plant Science 80: 929-938.

      Hyvonen, T. 2011. Vliv teploty a doby klíčení na úspěšnost [C.sub.4] plevele v [C.sub.3] plodině: Amaranthus retroflexus a jarní ječmen. Zemědělství a potravinářství 20: 183-190.

      Iamonico, D. 2010. Biologie, životní strategie a invazivita Amaranthus retroflexus L. (Amaranthaceae) ve střední Itálii: předběžné poznámky. Botanica Serbica 34: 137-145.

      Itoh, K., M. Azmi & A. Ahmad. 1992. Rezistence k paraquatu u Solanum nigrum, Crassocephalum crepidioides. Amaranthus lividus a Conyza sumatrensis v Malajsii. 1. mezinárodní kongres o kontrole plevele. Melbourne, Austrálie 2: 224-228.

      Jacobsen, S. E., A. Mujica & L. Guarino. 2000. Genetické zdroje andské obilné plodiny amarantu (Amaranthus caudatus L., A. cruentus L. a A. hipochondriacus L.). Sborník příspěvků z mezinárodní konference Věda a technologie pro řízení genetické rozmanitosti rostlin v 21. století. Kuala Lumpur, Malajsie, 12.–16. června.

      Jahaniaval, F., Y. Kakuda & M. F. Marcone. 2000. Složení mastných kyselin a triacylglykolů v olejích ze semen pěti druhů Amaranthus a jejich srovnání s jinými oleji. Journal of the American Oil Chemists' Society 77: 847-852.

      Jha, P., J. K. Norsworthy & M. S. Malik. 2007. Účinky zpracování půdy a tvorby zápoje sóji na dočasné vzcházení amarantu palmového z přirozené semenné banky. Společnost pro vědu o plevelu 60.

      --, --, M. B. Riley & W. Bridges Jr. 2008a. Aklimatizace amarantu palmového (Amaranthus palmeri) na stínování. Weed Science 56: 729-734.

      --, --, --, & . 2008b. Vliv načasování glyfosátu a šířky řádku na demografii amarantu palmového (Amaranthus palmeri) a puškvorce (Richardia spp.) u sóji rezistentní vůči glyfosátu. Weed Science 56: 408-115.

      --, --, --&--. 2008c. Požadavky na teplotu a světlo pro klíčení amarantu palmového po dobu 12 měsíců. Weed Science 58: 426-432.

      --, --, --&--. 2010. Roční změny v požadavcích na teplotu a světlo pro klíčení semen amarantu palmového (A. palmeri) získaných z půdy. Weed Science 58: 426-432.

      Julien, M. H. 1992. Biologická kontrola plevelů. Světový katalog agentů a jejich cílového plevele. 3. vydání, str. 186.

      Kadman-Zahavi, A. 1960. Vliv krátkých a kontinuálních iluminací na klíčení semen Amaranthus retroflexus. Bulletin izraelské výzkumné rady 9: 1-20.

      Kagali, R. N., E. N. Kioko, Z. Osiemo, S. Muya & C. Wachera. 2013. Početnost a diverzita hmyzu na kultivovaných Amaranthus spp. (Amaranthacea) v okrese Meru v Keni. American International Journal of Contemporary Research 3: 110-116.

      Karssen, C. M. 1982. Sezónní vzorce dormance v semenech plevelů. In: Khan, A.A. (ed) Fyziologie a biochemie vývoje semen, dormance a klíčení. Amsterdam: Elsevier Biomedical Press s. 243-270.

      Kataryan, B. T. 1975. Hledání bakteriálních kultur s herbicidní aktivitou. Doklady Akademii Nauk Armyanskoi SSR 61: 110-112.

      Keeley, P. E. & R. J. Thullen. 1989. Růst a konkurence hluchavce černé (Solanum nigrum) a amarantu palmového (Amaranthus palmeri) s bavlníkem (Gossypium hirsutum). Weed Science 37: 326-334.

      --, C. H. Carter & R. J. Thullen. 1987. Vliv termínu výsadby na růst amarantu palmového (Amaranthus palmeri). Weed Science 35: 199-204.

      Kegode, G. O., R. B. Pearce & T. B. Bailey. 1998. Vliv kolísavých teplot na vzejití shattcrcanc (Sorghum bicolor) a lišajník obrovský (Setaria faberi). Weed Science 46: 330-335.

      Kendig, J. A. 2009. Management amarantu palmového (Amaranthus palmeri). K dispozici na http://ncc.confex. com/ncc/2006/techprogram/P4499.html.

      Kendrick, R. E., & B. Frankland. 1969. Fotokontrola klíčení u Amaranthus caudatus. Planta 85: 326-339.

      --, C. J. P. Spruit & B. Frankland. 1969. Fytochrom v semenech Amaranthus caudatus. Planta 88: 293-302.

      --& M. Bihun. 2002. Vyvolání sekundární dormance u semen A. caudatus. Regulace růstu rostlin 38: 135-140.

      --& P. Sznigir. 2012. Reakce semen Amaranthus retroflexus L. na kyselinu giberelovou, etylen a kyselinu abscisovou v závislosti na délce stratifikace a pohřbívání. Regulace růstu rostlin 70: 15-26.

      --, E. Corbineau & D. Přijďte. 1996. Reakce semen Amaranthus retroflexus na cthephon, 1-aminocyklopropan-1-karboxylovou kyselinu a kyselinu giberelovou ve vztahu k teplotě a dormanci. Plant Growth Regulation 20: 259-265.

      --, E. Kepczynska & M. Bihun. 2003. Účast ethylenu na uvolňování primární dormance v semenech A. retroflexus. Regulace růstu rostlin 38: 57-62.

      Khan, A. G., G. M. Baloch & M. A. Ghani. 1978. Přirození nepřátelé Abutilonu, Amaranthus, Rumex a Sorghum. Commonwealth Institute of Biological Control. Výkaz prací leden 1977 42-43.

      Khanh, T. D., I. M. Chung, T. D. Xuan & S. Tawata. 2005. Využití rostlinné alelopatie v udržitelné zemědělské produkci. Journal of Agronomy and Crop Science 191: 172-184.

      Khoshoo, T. N. & M. Pal. 1972. Cytogenetické vzorce u Amaranthus. Chromosomes Today 3: 259-267.

      Kigel, J. 1994. Vývoj a kofyziologie amarantů. Amaranth: Biologie, chemie a technologie 39-73.

      --, M. Ofir & D. Koller. 1977. Kontrola odpovědí na klíčení semen Amaranthus retroflexus L. jejich rodičovským fototermálním prostředím. Journal of Experimental Botany 28: 1125-1136.

      Klingaman, T. E. & L. R. Oliver. 1994.Palmer amarant (Amaranthus palmeri) interference v sójových bobech (Glycine max). Weed Science 42: 523-527.

      Knezevic, S. Z. & M. J. Horák. 1998. Vliv doby vzejití a hustoty na prasečník rudý (Amaranthus retroflexus). Weed Science 46: 665-672.

      --, S. F. Weise & C. J. Swanton. 1994. Interference prasečího (Amaranthus retroflexus) v kukuřici (Zea mays). Weed Science 42: 568-573.

      Kolaib, M. O., M. F. W. Younes & E. T. E. Darwish. 1986. Hypolixus nubilosus jako faktor biologické kontroly plevelů Amaranthus v Egyptě. Annals of Agricultural Science 31: 767-776.

      Koul, A. K., A. K. Wakhlu & J. L. Karihaloo. 1976. Počty chromozomů některých kvetoucích rostlin Jammu (Západní Himálaje) II. Chromosome Information Service 20: 32-33.

      Kulakow, P. A. 1990. Jednoduše zděděná genetická variace v obilném amarantu. In: Janick, J. and Simon, J. E. (eds.) Advances in New Crops. Lis na dřevo. Portland. NEBO. USA.

      Kunth, K. S. 1838. Flora Bcrolinensis, Duncker a Humblot, Berlín, Německo 2: 144-145.

      Lanta, V., P. Havránek & V. Ondřej. 2003. Morfometrická analýza a klíčení semen Amaranthus cruentus, A. retroflexus a jejich hybrid (A. x mricensis). Plant Soil and Environment 49: 364-369.

      Legleiter, T. R. & K. W. Bradley. 2008. Rezistence vůči glyfosátu a více herbicidům v populacích konopí obecných (Amaranthus rudis) z Missouri. Weed Science 56: 582-587.

      Lehmann, J. W. 1996. Případová historie zrna Amaranthus a alternativní plodiny. Cereal Foods World 41: 399411.

      Leon, R.G. & M.D.K. Owen. 2003. Regulace dormance semen plevele prostřednictvím interakcí světla a teploty. Weed Science 51: 752-758.

      --&--. 2006. Systémy zpracování půdy a vliv dormance semen na vzcházení sazenic konopí obecného (Amaranthus tuberculatus). Weed Science 54: 1037-1044.

      --, A. D. Knapp & M. D. K. Owen. 2004. Vliv teploty na klíčení konopí obecného (Amaranthus tuberculatus), lišajníku obrovského (Setaria faberi) a velevolistu (Abutilon theophrasti). Weed Science 52: 67-73.

      --, D. C. Basshami & M. D. K. Owen. 2007. Tepelná a hormonální regulace přechodu dormance-klíčení v semenech Amaranthus tuberculatus. Weed Research 47: 335-344.

      Leon-Camacho, M., D. L. Garcia-Gonzalez & R. Aparicio. 2001. Podrobná studie profilu tuků amarantového (Amaranthus cruentus L.). European Food Research and Technology 213: 349-355.

      Linné, C. 1753. Druh Plantarum, Laurcntius Salvius, Stockholm. Švédsko 2: str. 989.

      Litch, M. A. & M. Al-Kaisi. 2005. Strip-tillage na teplotě půdy semene a dalších fyzikálních vlastnostech půdy. Soil and Tillage Research 80: 233-249.

      Liu, F. & H. Stutzel. 2002. Zadržování vody v listech amarantu rostlinného (Amaranthus spp.) v reakci na vysychání půdy. European Journal of Agronomy 16: 137-150.

      Liu, J., A. S. Davis & P. ​​J. Tranel. 2012. Biologie pylu a dynamika šíření v konopí vodním (Amaranthus tuberculatus). Weed Science 60: 416-422.

      Lolas, P. H. 1981. Zasahování populace plevelů do ječmene a tabáku. In Panhellmic Congress of Geotechnical Research. Abstraktní. 24 instituce kapnou, Činohra. Řecko.

      Lolas, P. C. 1986. Zásah společenstva plevele do ječmene a tabáku (Nicotiana tabacum L.). Weed Research 26: 1-8.

      Long, J. J. & J. O. Berry. 1996. Tkáňově specifická a světlem zprostředkovaná exprese [C.sub.4] fotosyntetického NAD-dcpcndcnt jablečného enzymu amarantových mitochondrií. Plant Physiology 112: 473-482.

      --, J. L. Wang & J. O. Berry. 1994. Klonování a analýza [C.sub.4] fotosyntetického NAD-dependentního jablečného enzymu amarantových mitochondrií. Journal of Biological Chemistry 269: 2827-2833.

      Lopez, J.F.O., A.A. Garcia, M.A.D. Huato, M.H. Lara, F.J. Saenz-de-cabezon, I. Perez-Moreno & V. Marco-Mancebon. 2011. Výskyt a ztráty hmyzu způsobené fytofágními druhy u amarantu (Amaranthus hypocondriacus L.) v Puebla, Mexiko. African Journal of Agricultural Research 6: 5924-5929.

      Lorenz, K. & Y. S. Hwang. 1985. Lipidy u amarantů. Nutrition Reports International 31: 83-89.

      Macharia, C. & E. B. Peffley. 1995. Potlačení Amaranthus spinosus a Kochia scoparia: důkaz kompetice nebo alelopatie u Allium fistulosum. Ochrana plodin 14: 155-158.

      Madhusoodanan, K.J. & M.A. Nazeer. 1983. Srovnávací morfologie somatických karyotypů rostlinných amarantů a její fylogenetický význam. Cytologia 48: 237-244.

      Mahmudzadeh, A., M. Nojavan & Z. Bagheri. 2003. Studie vlivu různých ošetření na přerušení dormance a stimulaci klíčení semen divokého amarantu. Scientific Journal of Agriculture 26: 13-25.

      Malefyt, T. & W. B. Duke. 1984. Fytotoxicita pendimethalinu pro aksamitníky (Abutilon theophrasti) a amaranty powell (Amaranthus powellii). Weed Science 32: 520-524.

      Manley, B. S., H. P. Wilson & T. E. Hines. 1996. Vepřovice hladká (Amaranthus hybridus) a amarant lividní (A. lividus) reakce na několik imidazolinonových a sulfonylmočovinových herbicidů. Weed Technology 10: 835-841.

      Marayama, A., M. Yoshiyama & Y. Eashi. 1997. Možná účast beta kyanoalaninsyntázy na zvýšení aminokyselinového lusku semen cocklcbur v reakci na ethylen během období klíčení. Australian Journal of Plant Physiology 24: 751-757.

      Massinga, R.A. & R.S. Currie. 2002. Vliv amarantu palmového (Amaranthus palmeri) na výnos zrna kukuřičného (Zea mays), výnos a kvalitu píce. Weed Technology 16: 532-536.

      --, --, M. J. Horák & J. Boyer. 2001. Interference amarantu palmového v kukuřici. Weed Science 49: 202-208.

      --, -- & T. P. Trooien. 2003. Využití vody a zachycování světla pod amarantem palmovým (Amaranthus palmeri) a konkurencí kukuřice. Weed Science 51: 523-531.

      Mayo, C. M., M. J. Horak, D. E. Peterson & J. E. Boyer. 1995. Diferenciální kontrola čtyř druhů Amaranthus šesti postemergentními herbicidy v sóji (Glycine max). Weed Technology 9: 141-147.

      McKeon, G. M. & J. J. Mott. 1982. Vliv teploty na polní měknutí tvrdého semene Stylosanthes humilus a S. hamata v suchém monzunovém klimatu. Australian Journal of Agricultural Research 33: 75-85.

      McLachlan, S. M., C. J. Swanton, S. F. Weise & M. Tollenaar. 1993a. Vliv zastínění a teploty vyvolané komárem na rychlost výskytu listů u prasečího rodu (Amaranthus retroflexus L.). Weed Science 41: 590-593.

      --, M. Tollenaar, C. J. Swanton & S. F. Weise. 1993b. Vliv zastínění vyvolaného kom na akumulaci sušiny, distribuci a architekturu prasečího druhu (Amaranthus retroflexus). Weed Science 41: 568-573.

      McIntyre, T. & G. M. Lewis. 1997. Pokroky fytoremediace jako inovativní environmentální technologie pro stabilizaci, sanaci a obnovu kontaminovaných míst. Journal of Soil Contamination 6: 227-231.

      Mcmullan, P. M. & J. M. Green. 2011. Identifikace biotypu vysokého vodního konopí (Amaranthus tuberculatus) odolného vůči herbicidům inhibujícím HPPD, atrazinu a thifensulfuronu v Iowě. Weed Technology 25: 514-518.

      McWilliams, E.L., R.Q. Landers & J.P. Mahlstede. 1968. Variace v hmotnosti semen a klíčivosti v populaci Amaranthus retroflexus L. Ecology 49: 290-296.

      Mellem, J. J. 2008. Fytoremediace těžkých kovů u Amaranthus dubius. (Disertační práce).

      Mendoza, G. L. & M. M. Rodriguez. 1990. Aislamiento, identifikace patogenních bakterií en quelite Amaranthus hybridus L. a su posibilidad en el control biologico. Revista Chapingo 15: 66-69.

      Menges, R M. 1987. Alelopatické účinky amarantu palmového (Amaranthus palmeri) a dalších rostlinných zbytků v půdě. Weed Science 35: 339-347.

      -. 1988. Alelopatické účinky amaranthus palmer (Amaranthus palmeri) na růst semenáčků. Weed Science 36: 325-328.

      Meyers, S.L., K.M. Jennings, J.R. Schultheis & D.W. Monks. 2010. Interference amarantu palmového (Amaranthus palmeri) ve sladkých bramborách. Weed Science 58: 199-203.

      Milan, P. R. 2008. Chování a plodnost chromozomů u indukovaných polyploidů amarantů obilných. Caryologia 61: 199-205.

      Milberg, P. & L. Andersson. 1997. Sezónní variace v dormanci a citlivosti na světlo v pohřbených semenech osmi jednoletých druhů plevelů. Canadian Journal of Botany 75: 1998-2004.

      Mintz, A. S. & G. J. Weidemann. 1992. Hodnocení Aposphaeria amaranthi jako potenciálního bioherbicidu pro Amaranthus. In Biological Control of Weeds, 8. mezinárodní sympozium s. 68.

      Mitich, L. W. 1997. Prasečník červený (Amaranthus retroflexus). Weed Technology 11: 199-202.

      Mlakar, S. G., M. Turínek, M. Jakop, M. Bavec & F. Bavec. 2009. Nutriční hodnota a využití obilného amarantu: potenciální budoucí využití při výrobě chleba. Agricultura 6: 43-53.

      Mnkeni, A. P. 2005. Nedostatečně využívaná rostlina s vysokou nutriční kvalitou a ekonomickým potenciálem. Výzkumný ústav zemědělství a rozvoje venkova, informační bulletin, University of Fort Hare. července do prosince 2005.

      Mohler, C. L. 1993. Model účinků zpracování půdy na vzcházení sazenic plevelů. Ekologické aplikace 3: 53-73.

      Monks, D. M. & L. R. Oliver. 1988. Interakce mezi kultivary sóji (Glycine max) a vybranými plevely. Weed Science 36: 770-774.

      Moolani, M. K., E. L. Knake & F. W. Slife. 1964. Soutěž prasečáku hladkého s kukuřicí a sójou. Weeds 12: 126-128.

      Moore, T. C. 1979. Biochemie a fyziologie rostlinných hormonů. New York: Springer-Verlag. s. 199-201.

      Moore, J.W., D.S. Murray & R.B. Westerman. 2004. Palmer amarant (Amaranthuspalmeri) účinky na sklizeň a výnos čiroku zrna (Sorghum bicolor). Technologie plevele 18: 23-29.

      Morgan, G. D., P. A. Baumann & J. M. Chandler. 1997. Vliv konkurence palmového amarantu na růst bavlny a výnos. Southern Weed Science Society 50: 149-150.

      --, --&--. 2001. Konkurenční dopad amarantu palmového (Amaranthus palmeri) na vývoj a výnos bavlny (Gossypium hirsutum). Weed Technology 15: 408-412.

      Mosyakin, S. L. & K. R. Robertson. 1996. Nové infragenerické taxony a kombinace v Amaranthus L. (Amaranthaceae). Annales Botanici Fcnnici 33: 275-281.

      --&--. 2003. Amaranthus. In: Flora of North America, Oxford University Press, New York 1: 410-435.

      Mposi, M. S. 1999. Zlepšení rostlinného amarantu pro Jižní Afriku. The Australian New Crops Newsletter, číslo 11.

      Mueller, T. C., L. E. Steckel, J. S. McElroy & T. C. Teuton. 2006. Aktualizace o odolnosti vůči herbicidům v Tennessee. Proceedings of the Southern Weed Science Society 59: 133.

      Muller, K. & T. Borsch. 2005. Fylogenetika amaranthaceae založená na datech sekvencí matK/trnK: Důkazy z úsporných, věrohodných a Bayesových analýz. Annals of the Missouri Botanical Garden 92: 66-102.

      Muller-Scharer, H. 1993. Biologická kontrola plevelů v plodinách: návrh nové akce COST. In: Maitrise des adventises par voie non chimique. Konference IFOAM, Dijon 181-185.

      Mulligan, G. A. 1984. Počet chromozomů některých rostlin původních a naturalizovaných v Kanadě. Naturaliste Canadien 111: 447-149.

      Munger, P. H., J. R. Abernathy & J. R. Gipson. 1983. Vliv vybraných rostlinných zbytků na bavlnu (Abstrakt). In Proceedings of the Southern Weed Science Society 36th Annual Meeting, s. 37.

      Murray, M. J. 1938. Mezidruhové a mezirodové křížení v čeledi Amaranthaceae. Ph.D. Teze. Cornell University, Ithaca, New York.

      --1940. Genetika určování pohlaví v čeledi Amaranthaceae. Genetics 25: 409-431.

      Myers, R. L. 1996. Amaranth: Nová příležitost pro plodiny, s. 207-220. In: J. Janick (ed.). Pokrok v nových plodinách. ASHS Press, Alexandria, VA.

      -. 1998. Účinek dusíkatých hnojiv na zrno amarantu. Agronomy Journal 90: 597-602.

      --&--1988. Pěstování amarantu jako speciální plodiny. Komunikační a vzdělávací technologické služby, University of Minnesota Extension.

      Nandula, V. K., J. D. Ray, D. N. Ribeiro, Z. Pan & K. N. Reddy. 2013. Odolnost proti glyfosátu u konopí vysokého (Amaranthus tuberculatus) z Mississippi je způsobena jak změněnými mechanismy cílového místa, tak mechanismy necílového místa. Weed Science 61: 374-383.

      Napompeth, B. 1982. Výzkum a vývoj biologické kontroly v Thajsku. In Proceedings of the International Conference on Plant Protection Tropics, Kuala Lumpur. Malajsie, s. 301-323.

      -. 1989. Biologická kontrola hmyzích škůdců a plevelů v Thajsku. Biologická kontrola škůdců. BIOTROP Special Publication 36: 51-68.

      -. 1992. Stručný přehled aktivit biologické kontroly v Thajsku. Biologická kontrola v jižní a východní Asii. Kjúšú University Press. Japonsko, s. 51-68.

      Narwall, S. S. 1994. Alelopatie v rostlinné výrobě. Vědecké nakladatelství: Jodhpur. str. 288.

      Národní akademie věd. 1975. Nedostatečně využívané tropické rostliny se slibnou ekonomickou hodnotou. Národní akademie věd, Washington, DC.

      Národní rada pro výzkum. 1984. Amarant: Moderní vyhlídky na prastarou plodinu. National Academy Press. Washington DC.

      Národní rada pro výzkum. 1989. Ztracené plodiny Inků. National Academy Press. Washington DC.

      Nordby, D., R. Hartzler & K. Bradley. 2010. Biologie a management konopí vodního. The Glyphosate, Weeds, and Crops Series, od Glyphosate, Weeds, and Crops Group (http://www. glyphosateweedscrops.org/). Vydalo Purdue Extension, Purdue University, Lafayette, Indiana. USA.

      Norsworthy, J. K. 2003. Využití průzkumů produkce sóji ke stanovení potřeb plevelů farmářů v Jižní Karolíně. Technologie plevele 17:195-201.

      -. 2004. Tvorba zápoje sóji má vliv na výskyt svlačec obecných (Ipomoea lacunosa), koukol obecný (Xanthium strumarium) a lusků srpkovitých (Senna obtusifolia). Weed Science 52: 954-960.

      --2005. Optimalizace načasování glyfosátu ve smíšeném stojanu konvenčních sójových bobů odolných vůči glyfosátu. Weed Technology 19: 942-946.

      --& M. J. Oliveira. 2007. Obdělávání půdy a účinky zápoje sóji na koukol obecný (Xanthium strumarium) emergcncc. Weed Science 55: 474-480.

      --, G. M. Griffith, R. C. Scott, K. L. Smith & L. R. Oliver. 2008. Potvrzení a kontrola amarantu palmového (Amaranthuspalmeri) odolného vůči glyfosátu v Arkansasu. Weed Technology 22: 108-113.

      O'Brien, G. K. & M. L. Price. 1983. Amarant: Obilný a zeleninový typ. Technická poznámka organizace Educational Concerns for Hunger Organization (ECHO). ECHO, North Fort Mycre, FL.

      Ogunyemi, S., R. O. Awodoyin & N. A. Otu. 2000. Chemická kontrola Ageratum conyzoides, Amaranthus spinosus a Cyperus rotundus v sójových bobech [Glycine max (L.) Merril.]. Journal of Tropical Forest Resources 16: 143-151.

      --, S. E. Ibrahim, O. O. Koleowo & R. O. Awodoyin. 2005. Konkurenční dopad Amaranthus spinosus v produkci Celosia argentia a Corchorus olitorius v jihozápadní Nigérii. Sborník z konference African Crop Science 6: 53-57.

      Oke, O. L. 1983. Amarant. In: Příručka tropických potravin. Marcel Dekker, New York, 1.

      Oladiran, J. A. & P. ​​M. Mumford. 1985. Stimulace klíčení semen teplotou a světlem u agronomických druhů Amaranthus. Biochcmie und Physiologic der Pflanzen 180: 45-54.

      Oliveira, J. S. & M. F. de Carvalho. 1975. Nutriční hodnota některých jedlých listů používaných v Mosambiku. Hospodářská botanika 29: 255-263.

      Omami, E. N. & R. W. Medd. 1992. Klíčení a reakce po zrání v semenech Amaranthus retroflexus. Sborník příspěvků z 1. mezinárodního kongresu pro kontrolu plevele 2: 372-374.

      --, A. M. Haigh, R. W. Medd & H. I. Nicol. 1999. Změny klíčivosti, dormance a životaschopnosti A. retroflexus v závislosti na hloubce a délce pohřbu. Weed Research 39: 345-354.

      Ortiz Ribbing, L. M. & M. Williams. 2006. Potenciál Phomopsis amaranthicola a Microsphaeropsis amaranthi jako biohcbicidků pro několik plevelných druhů Amaranthus. Ochrana plodin 25: 39-46.

      Orwick, P. L. & M. M. Schreiber. 1979. Interference prasečího (Amaranthus retroflexus) a náprstníku robustního (Setaria viridis var. robusta-alba nebo var. robusta-purpurea) v sóji (Glycine max). Weed Science 27: 665-674.

      Oryokot, J.O.E., S.D. Murphy & C.J. Swanton. 1997. Vliv zpracování půdy a kukuřice na vzcházení a hustotu semenáčků prasečího (Amaranthus spp.). Weed Science 45: 120-126.

      Pal, M. 1964. Chromozonová čísla v některých indických angiospemech. Proceedings: Plant Sciences 60: 347-350.

      -. 1971. Polyhaploidní rostlina Amaranthus dubius. Indian Journal of Genetics and Plant Breeding 31: 397-402.

      -. 1972. Vnitrodruhová ankuploidie u Amaranthus graecizans. Current Science 41: 262-263.

      --& T. N. Khoshoo. 1973. Evoluce a zdokonalení pěstovaných amarantů. VI. Cytogenní vztahy v typech zrn. Theoretical and Applied Genetics 43: 242-251.

      --& T. N. Khoshoo. 1974. Amaranty obilné. Evoluční studie světových plodin. Cambridge University Press. Cambridge. 129.

      --& R. M. Pandey. 1989. Cytogenetika a evoluce amarantů obilných. Aspects of Plant Science 11:323 336.

      --, R. M. Pandey & T. N. Kashoo. 1982. Evoluce a zdokonalení pěstovaných amarantů. IX.

      Cytogenetický vztah mezi dvěma základními čísly chromozomů. Journal of Heredity 73: 353-356.

      --, D. Ohri & G. V. Subrahmanyam. 2000. Nové základní číslo chromozomů pro Amaranthus (Amaranthaccae). Cytologia 65: 13-16.

      Palada, M. C. & L. C. Chang. 2003. Doporučené kulturní postupy pro rostlinné amaranty: Průvodce mezinárodními spolupracovníky.

      Patzoldt, W. L. & P. ​​J. Tranel. 2007. Mnohočetné mutace ALS propůjčují herbicidům odolnost vůči konopí vodnímu (Amaranthus tuberculatus). Weed Science 55: 421-428.

      --, --& A. G. Hager. 2005. Biotyp vodního konopí (Amaranthus tuberculatus) s mnohonásobnou rezistencí napříč třemi místy účinku herbicidu. Weed Science 53: 30-36.

      Peters, I. & S. Jain. 1985. Genetická variace sexuálního projevu kultivována Amaranthus spp. - řešení mnoha hádanek. American Journal of Botany 72: 878.

      --&--. 1987. Genetika amarantů obilných III. 3. Genová cytoplazmatická samčí sterilita. Journal of Heredity 78: 251-256.

      Peterson, D. E. 1999. Vliv plevelů odolných vůči herbicidům v Kansasu. Weed Technology 13: 632-635.

      Petr, J., I. Michalík, H. Tlaskalová, 1. Čapouchová, O. Famera, D. Urmínská, L. Tuková & H. Knoblochová. 2003. Rozšíření spekter rostlinných produktů pro dietu u celiakie. Český časopis potravinářských věd 21: 59-70.

      Plate, A. V. A. & J. A. G. Areas. 2002. Účinek extrudovaného amarantu (Amaranthus caudatus L.) na snížení cholesterolu u hypercholesterolemických králíků. Chemie potravin 76: 1-6.

      Powles, S. B. 2008. Vyvinuté plevele odolné vůči glyfosátu po celém světě: poučení. Pest Management Science 64: 360-365.

      Pratt, D.B., M.D.K. Owen, L.G. Clark & ​​A. Gardner. 1999. Identifikace plevelných prasečích a vodních konopí v Iowě.Iowa State University, University Extension.

      Price, A. J., K. S. Balkcom, S. A. Culpepper, J. A. Kelton, R. L. Nichols & H. Schomberg. 2011. Amarant palmový odolný vůči glyfosátu: Hrozba pro konzervační zpracování půdy. Journal of Soil and Water Conservation 66: 265-275.

      Putnam, D. H., E. S. Oplinger & E. M. Schulte. 1989. Amaranth: Manuál alternativních polních plodin. Centrum pro alternativní rostlinné a živočišné produkty. Minnesota Extension Service, University of Minnesota, St. Paul, MN 55108.

      Qasem, J. R. 1994. Alelopatické účinky vepřovice (Amaranthus spp.) na ječmen (Hordeum vulgare). Dirasat 21: 101-120.

      -. 1995a. Alelopatické účinky Amaranthus retroflexus a Chenopodium murale na zeleninové plodiny. Allelopathy Journal 2: 49-66.

      -. 1995b. Alelopatické účinky tří Amaranthus spp. (prasenice) na pšenici (Triticum durum). Weed Research 35: 41-49.

      Railey, K. 1993. Amarant: Zdravé obilí pro vegetariánské recepty. Health & Beyond Online.

      Ramesh, B. & P. ​​Kumar. 2009. Analýza meiotických chromozomů u interspecifických fl hybridů amarantů obilných. Journal of Biological Sciences 1: 105-112.

      Rana, J. C., K. Pradheep, S. K. Yadav, V. D. Verma & P. ​​C. Sharma. 2007. Durga: Nová odrůda obilného amarantu pro pěstování v horských oblastech. Indické zemědělství 57: 27-28.

      Randall, R. P. 2007. The global compendium of weeds (http://www.hear.org/gcw/). AgWest a projekt Hawaiian Ecosystems at Risk (HEAR).

      Rayburn, A. L., R. McCloskey, T. C. Tatum, G. A. Bollero, M. R. Jeschke & P. ​​J. Tranel. 2005. Analýza velikosti genomu plevelných druhů Amaranthus. Crop Science 45: 2557-2562.

      Regnier, E. E. & S. K. Harrison. 1993. Kompenzační reakce koukol obecný (Xanthium strumarium) a aksamitníku (Abutilon theophrasti) na částečné zastínění. Weed Science 41: 541-547.

      Rezaie, F. & M. Yarnia. 2009. Alelopatické účinky Chenopodium album, Amaranthus retroflexus a Cynodon dactylon na klíčení a růst světlice barvířské. Journal of Food. Zemědělství a životní prostředí 7: 516-521.

      Riggins, C. W., Y. H. Peng, C. N. Stewart & P. ​​J. Tranel. 2010. Charakterizace de novo transkriptomu pro konopí vodní (Amaranthus tuberculatus) pomocí pyrosekvenování GS-FLX 454 a její aplikace pro studium genů pro cílové místo herbicidu. Pest Management Science 66: 1042-1052.

      Rizvi, S.J.H. & V. Rizvi. 1992. Alelopatie: Základní a aplikované aspekty. První vydání. Chapman a Hall.

      Robertson, K. 1981. Rody Amaranthaccac v jihovýchodních Spojených státech. Journal of the Arnold Arboretum 62: 267-314.

      Rodriguez-Gacio, M. C., M. A. Matilla-Vazquez & A. J. Matilla. 2009. Dormance semen a signalizace ABA: průlom pokračuje. Signalizace a chování rostlin 4: 1035-1049.

      Rowland, M. W., D. S. Murray & L. M. Verhalen. 1999. Celosezónní amarant (Amaranthus palmeri) interference s bavlníkem (Gossypium hirsutum). Weed Science 47: 305-309.

      Rushing, D.W., D.S. Murray & L.M. Verhalen. 1985. Zásah plevele do bavlny (Gossypium hirsutum). II. Prasečník obecný (Amaranthus albus). Weed Science 33: 815-818.

      Sage, R. F., T. L. Sage, R. W. Pearcy & T. Borsch. 2007. Taxonomická distribuce [C.sub.4] fotosyntézy u Amaranthaceae sensu stricto. American Journal of Botany 94: 1992-2003.

      Santelmann, P. W. & L. Evetts. 1971. Klíčení a herbicidní citlivost šesti druhů prasat. Weed Science 19: 51-54.

      Sanz-Penella, J. M., M. Wronkowska, M. Soral-Smietana & M. Haros. 2013. Vliv celozrnné mouky amarantli na vlastnosti chleba a nutriční hodnotu. Food Science and Technology 50: 679-685.

      Sattin, M., M. C. Zuin & I. Sartorato. 1994. Světlá kvalita pod vrchlíky kukuřice, sóji a pšenice pěstované na poli – červená: daleko červené variace. Physiologia Plantarum. 91: 322-328.

      Sauer, J. D. 1950. Obilné amaranty: přehled jejich historie a klasifikace. Annals of the Missouri Botanical Garden 37: 561-632.

      -. 1955. Revize amarantů dvoudomých. Madrono 13: 5-46.

      -. 1957. Střední migrace a evoluce amarantů dvoudomých. Evoluce 11: 11-31.

      -. 1967. Amarantové obilí a jejich příbuzní: revidovaný taxonomický a geografický přehled. Annals of the Missouri Botanical Garden 103-137.

      -. 1993. Amaranthaceaes: Amaranth family. In Historical Geography of Crop Plants: a Select Roster: CRC Press: Boca Raton, FL str. 9-14.

      Saunders, R. M. & R. Becker. 1984. Amaranthus: Potenciální zdroj potravy a krmiva. Advances in Cereal Science and Technology 6: 357-396.

      Schippers, R. R. 2000. Africká původní zelenina: Přehled pěstovaných druhů. Chatham UK. Institut přírodních zdrojů/Technické centrum AKT-EU pro zemědělské zdroje a spolupráci venkova.

      Schonbeck, M. W. & G. H. Egley. 1981a. Fázová sekvence odpovědí klíčení semen vepřovice na ethylen a další podněty.I. Fyziologie rostlin 68: 175-179.

      --&--. 1981b. Změny citlivosti semen A. retroflexus L na ethylen během preinkubace. II.

      Účinky střídání teplot a pohřbívání v půdě. Plant Cell and Environment 4: 237-242.

      Schroeder, D., H. Miiller-Scharer & C.S.A. Stinson. 1993. Evropský průzkum plevele v 10 hlavních systémech plodin s cílem určit cíle biologické kontroly. Weed Research 33: 449-458.

      Schuester, M. 1987. Puchýřník v Paraguayi – potenciální prostředek biologické kontroly. Management tropických škůdců 33: 241.

      Schutz, W., P. Milberg & B. B. Lamont. 2002. Dormance semen, dozrávání a požadavky na světlo čtyř ročních hvězdnicovitých (Asteraceae) v jihozápadní Austrálii. Annals of Botany 90: 707-714.

      Scopel, A.L., C.L. Bailare & R.A. Sanchez. 1991. Indukce extrémní světelné citlivosti v zahrabaných semenech plevelů a její role ve vnímání kultivace půdy. Plant Cell Environment 14: 501-508.

      Scott, G. H., S. D. Askew & J. W. Wilcut. 2002. Glyfosátové systémy pro kontrolu plevele u bavlny tolerantní ke glyfosátu (Gossypium hirsutum). Weed Technology 16: 191-198.

      Segura-Nieto, M., A. P. Barba de la Rosa & O. Peredes-Lopez. 1994. Biochemie amarantových proteinů. Amaranth: Biologie, chemie a technologie 75-106.

      Sellers, B. A., R. J. Smeda, W. G. Johnson, J. A. Kendig & M. R. Ellersieck. 2003. Srovnávací růst šesti druhů Amaranthus v Missouri. Weed Science 51: 329-333.

      Senft, J. P. 1980. Proteinová kvalita amarantového zrna, s. 43-47. In: Sborník příspěvků z druhé amarantové konference. Rodale Research Report (3).

      Senseman. S. A., H. G. Hancock, R. D. Wauchope, K. L. Armburst, T. J. Peters, J. H. Massey, D. H. Johnson, J. Reynolds, F. Lichtner, G. E. MacDonald, D. W. Rushing, D. Kitner, H. S. McLean & W. Vencill 2007. Příručka herbicidů 9. vydání. Weed Science Society of America Lawrence, KS. str. 458.

      Shagal, M. H., H. M. Maina, R. B. Donatus & K. Tadzabia. 2012. Bioakumulace koncentrace stopových kovů v některé zelenině pěstované v blízkosti skládek odpadu a odpadních vod podél obchvatu Rumude-Doubeli v Yola North, stát Adamawa. Global Advanced Research Journal of Environmental Science and Toxicology 1: 18-22.

      Shahrokhi, S., M. Darvishzadeh, M. Mehrpoovan & M. Farboodi. 2012. Srovnání alelopatických účinků extraktů různých orgánů Amaranthus retroflexus L. na klíčení a počáteční růst kultivaru pšenice Alvand a Zarrin. International Journal of Agronomy and Plant Production 3: 489-494.

      Sharma, A. K. & M. Banik. 1965. Cytologický výzkum různých rodů Amaranthaceae s cílem vysledovat jejich vzájemné vztahy. Bulletin Botanické společnosti Bengálska 19: 40-50.

      Sheidai, M. & Z. Mohammadzadeh. 2008. Cytogenetická studie druhů Amaranthus L. v Íránu. Cytologie 73: 1-7.

      Sheikh, S. M. & O. Singh. 2013. Pscudockrcals a proso: ztracené plodiny Kašmíru. Genetic Resources and Crop Evolution 60: 1191-1199.

      Shewry, P. R. 2002. Hlavní zásobní proteiny semen pšenice špaldy, čiroku, prosa a pseudocereálií. In: Belton P, Taylor J teds.), Pseudocereálie a méně obvyklé obiloviny, vlastnosti zrna a potenciál využití. Springer-Verlag: 1-24.

      Shimi, P. & F. Termeh. 2004. Weeds of Iran. Organizace zemědělského výzkumu, vzdělávání a rozšíření. Teherán, Írán. str. 36.

      Shoup, D. E., K. Al-Khatib & D. E. Peterson. 2003. Rezistence konopí obecného (Amaranthus rudis) k herbicidům inhibujícím protoporfyrinogen oxidázu. Weed Science 51: 145-150.

      Shrefler, J.W., W.M. Stall & J.A. Dusky. 1996. Amarant ostnatý (Amaranthus spinosus L.), vážný konkurent hlávkového salátu (Lactuca sativa L.). Horticulture Science 31: 347-348.

      Sibony, M. & B. Rubin. 2002. Ekologická způsobilost Amaranthus retroflexus rezistentního vůči ALS a mnohonásobně rezistentního Amaranthus blitoides. Weed Research 43: 40-47.

      Simbolon, H. & H. Sutarno. 1986. Reakce druhů Amaranthus na různé intenzity světla. Buletin Penelitian Hortikultura 13: 33-42.

      Singh, U. O., A. M. O. Wadhwani & B.M. Johri. 1983. Slovník hospodářských rostlin Indie. Slovník hospodářských rostlin v Indii, (ed. 2).

      Singhal, R. S. & P. ​​R. Kulkarni. 1988. Recenze: Amaranty – nedostatečně využívaný zdroj. International Journal of Food Science & Technology 23: 125-139.

      Singhal, B. K. & D. N. Sen. 1981. Alelopatický potenciál prasečího (Amaranthus viridis Linn.) na deštěm krmených plodinách indické pouště. Geobios 21: 213-221.

      Siriwardana, G. D. & R. L. Zimdahl. 1984. Konkurence mezi trávou chlévskou (Echinochloa crus-galli) a prasečím (Amaranthus retroflexus). Weed Science 32: 218-222.

      Smith, H. 1995. Fyziologická a ekologická funkce v rámci rodiny fytochromů. Roční přehled biologie rostlin 46: 289-315.

      Smith, D. T., R. V. Baker & G. L. Steele. 2000. Láskavec palmový (Amaranthus palmeri) má dopad na výnos, sklizeň a vyzrňování bavlny suché (Gossypium hirsutum). Technologie plevele 14: 122-126.

      Song, B., X. Zhang, F. Li & P. ​​Wan. 2002. Počet chromozomů 14 druhů u Amaranthus z Číny. Acta Phytotaxonomica Sinica 40: 428-432.

      Soomarin, S.J., S. Alipoor & R. Z. Mahmoodabad. 2010. Hodnocení aplikace kyseliny sírové při porušování dormance semen merlíku a amarantu červenokořenného. Plant Ecophysiology 2: 127-131.

      Souza, M. C. D., L. B. D. Carvalho, P. L. D. C. A. Alves & P. ​​R. F. Giancotti. 2011. Alelopatie u prasečího (recenze). Komunikace v rostlinných vědách 1: 5-12.

      Spalding, R. F., D. G. Watts, D. D. Snow, D. A. Cassada, M. E. Exner & J. S. Schepers. 2003. Zátěž herbicidů do mělkých podzemních vod pod oblastí hodnocení systémů řízení Nabrasky. Journal of environmental quality 32: 84-91.

      Spencer, K. A. & D. Havránek. 1989. Nový druh Agromyzidae (Diptera) z Venezuely. Florida Entomologist 72: 441-444.

      --& G. C. Steyskal. 1986. Manuál Agromyzidae (Diptera) ze Spojených států. Ministerstvo zemědělství Spojených států amerických. Zemědělská příručka, USDA 638.

      Sprague, L. C., E. W. Stroller, L. M. Wax & M. J. Horák. 1997. Palmer amarant (Amaranthus palmeri) a konopí obecná (Amaranthus rudis) odolnost vůči vybraným herbicidům inhibujícím ALS. Weed Science 45: 192-197.

      Spreeth, M. H., M. M. Slabbert, J. A. De Ronde, E. Van Den Heever & A. Ndou. 2004. Screening cowpca, bambara podzemnice a Amaranthus gcrmplasm na odolnost vůči suchu a testování vybraného rostlinného materiálu za účasti cílových komunit. Zpráva WRC č. 944/1/04.

      Srivastava, R. 2011. Nutriční kvalita některých pěstovaných a volně žijících druhů Amaranthus L. International Journal of Phamaceutical Science and Research 2: 3152-3156.

      Srivastava, R. & B. K. Roy. 2012. Cytogenetické studie: karyotypické a evoluční aspekty některých kulturních a divokých druhů Amaranthus L. International Journal of Innovations in Bio-Sciences 2: 154-156.

      Stallknecht, G. F. & J. R. Schulz-Schaeffer. 1993. Amarant znovu objeven. Nové plodiny. Wiley. New York: 211-218.

      Steckel, L. E. 2004. Pigweeds v Tennessee. University of Tennesse.

      -. 2007. Amaranthus spp. dvoudomé: zde zůstat. Weed Technology 21: 567-570.

      --, C. L. Sprague, A. G. Hager, F. W. Simmons & G. A. Bollero. 2003. Účinky zastínění na růst a vývoj konopí obecného (Amaranthus rudis). Weed Science 51: 898-903.

      --, C. L. Sprague, E. W. Stoller & L. M. Wax. 2004. Vliv teploty na klíčení devíti druhů Amaranthus. Weed Science 52: 217-221.

      --, C. L. Main, A. T. Ellis & T. C. Mueller. 2008. Palmer amarant (Amaranthus palmeri) v Tennessee má nízkou úroveň odolnosti vůči glyfosátu. Technologie plevele 22: 119-123.

      Steinau, A. N., D. Z. Skinner & M. Steinau. 2003. Mechanismus extrémní genetické rekombinace u plevelných hybridů Amaranthus. Weed Science 51: 696-701.

      Stevens, O. A. 1924. Některé účinky mrazu prvního pádu. American Midland Naturalist 9: 14-17.

      -. 1932. Počet a hmotnost semen produkovaných plevelem. American Journal of Botany 19: 784-794.

      Stoller, E. W. & R. A. Myers. 1989. Reakce sójových bobů (Glycine max) a čtyř širokolistých plevelů na sníženou radiaci. Weed Science 37: 570-574.

      Suma, S. 1998. Stručná studie o environmentální fyziologii Amaranthus spinosus L. Thesis, Doctorate, Bangalore University. Bangalore.

      Sun, H., D. Wiesenborn, K. Tostenson, J. Gillespie & P. ​​Rayas-Duarte. 1997. Frakcionace skvalenu z oleje ze semen amarantu. Journal of the American Oil Chemists' Socicty 74: 413-418.

      Swanton, C. J., J. Z. Huang, W. Deen, M. Tollenaar, A. Shrestha & H. Rahimian. 1999. Účinky teploty a fotoperiody na fenologický vývoj Setaria viridis. Weed Science 47: 446-453.

      Sweat, J. K., M. J. Horak, D. E. Peterson, R. W. Lloyd & J. E. Boyer. 1998. Herbicidní účinnost na čtyři druhy Amaranthus v sóji (Glycine max). Weed Technology 12: 315-321.

      Szmedra, P. 1997. Zákaz 2,4-D a fenoxy herbicidů: potenciální ekonomický dopad. Weed Science 45: 592-598.

      Takabayashi, M. & K. Nakayama. 1981. Sezónní změna v dormanci semen hlavních horských plevelů. Weed Research 26: 249-253.

      Takagi, F. 1933. Uber die Chromosomen-Zahlen bei einigen Amaranthus. Arten. Botanický časopis 47: 556-557.

      Tardif, F. J., I. Rajcan & M. Costea. 2006. Mutace v cílovém místě herbicidu acetohydroxykyselina syntáza způsobuje morfologické a strukturální změny a snižuje zdatnost u Amaranthus powellii. Nový fytolog 169: 251-264.

      Taylorson, R. B. & H. A. Borthwick. 1969. Filtrace světla listovými baldachýny: význam pro klíčení semen plevelů řízené světlem. Weed Science 17: 48-51.

      --& S. B. Hendricks. 1969. Působení fytochromu během předchlazení semen Amaranthus retroflexus L.. Plant Physiology 44: 821-825.

      --& S. B. Hendricks. 1971. Změny ve fytochromu vyjádřené klíčením semen Amaranthus retroflexus L.. Plant Physiology 47: 619-622.

      --& S. B. Hendricks. 1973. Podpora klíčení semen kyanidem. Fyziologie rostlin 52: 23-27.

      Teitz, A. Y., S. F. Gorski & M. B. McDonald. 1990. Dormance semen lividního amarantu Amaranthus lividus L.. Seed Science and Technology 18: 781-989.

      Telewski, F. W. & J. A. D. Zeevaart. 2002. Období 120 let pro experiment životaschopnosti semen Dr. Beala. American Journal of Botany 89: 264-270.

      Teutonico, R.A. & D. Knorr. 1985. Amarant: Složení, vlastnosti a aplikace znovuobjevené potravinářské plodiny. Technologie potravin 39: 49-60.

      Thomas, W. E., 1. C. Burke, J. F. Spears & J. W. Wilcut. 2006. Vliv faktorů prostředí na klíčení amarantu štíhlého (Amaranthus viridis). Weed Science 54: 316-320.

      Thompson, K. 1987. Semena a seedbanka. Nový fytolog 106: 23-34.

      Thompson, T. 2001. Případový problém: Otázka týkající se přijatelnosti pohanky, amarantu, quinoy a outs od pacienta s celiakií. Journal of the American Dietetic Association 101: 586-587.

      Thompson, K. & J. P. Grime. 1983. Srovnávací studie klíčení v reakci na denní kolísání teplot. Journal of Applied Ecology 20: 141-156.

      Tisler, A. M. 1990. Krmení u blešivce prasečí. Disonycha glabrata Fab. (Coleoptera: Chrysomelidae), na Amaranthus retroflexus. Virginia Journal of Science 41: 243-245.

      Torres, P. C. B., A. A. Garcia, R. P. Aviles, L. R. Hernandez & J. F. L. Olguin. 2011. Entomofaunistická studie pěstování laskavce (Amaranthus hypochondriacus L.) v Puebla, Mexiko, Revesta Mexicana de Ciencias agricolas 2: 359-371.

      Tranel, P. J. & T. R. Wright. 2002. Odolnost plevelů vůči herbicidům inhibujícím ALS: co jsme se naučili? Weed Science 50: 700-712.

      --, W. Jiang, W. L. Patzoldt & T. R. Wright. 2004. Vnitrodruhová variabilita genu pro acetolaktátsyntázu. Weed Science 52: 236-241.

      Trucco, F., M. R. Jeschke, A. L. Rayburn & P. ​​J. Tranel. 2005a. Amaranthus hybridus může být v polních podmínkách často opylován A. tuberculatus. Dědičnost 94: 64-70.

      --, M. R. Jeschke, A. L. Rayburn & P. ​​J. Tranel. 2005b. Promiskuita u plevelných amarantů: vysoká frekvence hybridizace samic konopí vysokého (Amaranthus tuberculatus) x prasečáku hladkého (A. hybridus) v polních podmínkách. Weed Science 53: 46-54.

      --, D. Zheng, A. J. Woodyard, J. R. Walter, T. C. Tatum, A. L. Rayburn & P. ​​J. Tranel. 2007. Nehybridní potomci z křížení dvoudomých amarantů: důsledky pro výzkum toku genů. Weed Science 55: 119-122.

      --, T. Tatum, A. L. Rayburn & P. ​​J. Tranel. 2009. Ven z bažiny: Jednosměrná hybridizace s plevelnými druhy může vysvětlit prevalenci Amaranthus tuberculatus jako plevele. New Phytologist 184: 819-827.

      Uphof, J. C. 1968. Slovník hospodářských rostlin. Cramer: New York, str. 545.

      USDA, ARS. 1999. Národní program genetických zdrojů. Zdroje Germplasm.

      USDA, NRCS. 2010. Databáze rostlin (http://plants.usda.gov). Národní datové centrum závodu. Baton Rouge: 70,874-4490.

      Uusikua, N. P., A. Oelofsea, K. G. Duodub, M. J. Besterc & M. Faberd. 2010. Nutriční hodnota listové zeleniny subsaharské Afriky a její potenciální přínos pro lidské zdraví: Přehled. In: Journal of Food Composition and Analysis 23: 499-509.

      Vangessel, M. J. & K. A. Renner. 1990. Rušení vepřovice (Amaranthus retroflexus) a trávy (Echinochloa crus-galli) v bramborách (Solatium tuberosum). Weed Science 38: 338-343.

      Velu, G. & A. M. Ali. 1995. Alelopatický účinek vepřovice a portulaky koňské na Boerhaavia diffusa. Crop Research 10: 103-106.

      Vencill, W. K., T. L. Grey, A. S. Culpepper, C. Gaines & R. Westra. 2008. Herbicid-rezistence v Amaranthaccae. Journal of Plant Diseases and Protection 41-44.

      Vietmeyer, N. 1978. Úroda chudých lidí. Americká agentura pro mezinárodní rozvoj (USA) 1:12.

      Vigueira, C. C., K. M. Olsen & A. L.Caicedo. 2013. Červená královna v com: Zemědělské plevele jako modely rychlé adaptivní evoluce. Dědičnost 110: 303-311.

      Vogt, G. B. & H. A. Cordo. 1976. Nedávné jihoamerické terénní studie potenciálních činitelů biologické kontroly plevelů. In Proceedings of the Research Planning Conference on the Aquatic Plant Control Program, Charleston s. 36-55.

      Walter, J. & C. Dobes. 2004. Morfologické znaky, geografické rozšíření a ekologie neofytického Amaranthus blitum L. subsp. emarginatus v Rakousku. Annals of Natural History Museum, Vídeň, 105(B). Vídeň, Rakousko: Annals of Natural History Museum 645-672.

      Wang, J. L., J. J. Long, T. E. Hotehkiss & J. O. Berry. 1993. [C.sub.4] fotosyntetická genová exprese ve světle a tmavě rostoucích kotyledonech amarantu. Plant Physiology 102: 1085-1093.

      Wang, Y., Y. L. Meng, H. Ishikawa, T. Hibino, Y. Tanaka, N. Nii & T. Takabe. 1999. Fotosyntetická adaptace na solný stres u tříbarevných listů [C.sub.4] rostliny Amaranthus tricolor. Plant and Cell Physiology 40: 668-674.

      Ward, D. E. & R. W. Spellenberg. 1986. Počty chromozomů krytosemenných rostlin v západní Severní Americe. Phytologia 61: 119-125.

      Washitani, I. 1985. Polní osud semen Amaranthus patulus vystavených inhibici klíčení listovým zápojem. Occologia 66: 338-342.

      --& A. Takenaka. 1984. Klíčení populace nespících semen Amaranthus patulus Bertol. na konstantní teploty v suboptimálním rozsahu. Plant Cell and Environment 47: 353-358.

      Wassom, J. J. & P. ​​J. Tranel. 2005. Genetické vztahy mezi plevelnými druhy Amaranthus založené na polymorfismu délky fragmentu. Journal of Heredity 96: 410-416.

      Watanabe, T., Y. Murata & M. Osaki. 2009. Amaranthus tricolor má potenciál pro fytoremediaci půd kontaminovaných kadmiem. Komunikace ve vědě o půdě a analýze rostlin 40: 3158-3169.

      Waterhouse, D. F. 1994. Biologická kontrola plevelů: Vyhlídky jihovýchodní Asie. Australské centrum pro mezinárodní zemědělský výzkum 125.

      Weaver, S. E. 1984. Diferenciální růst a konkurenční schopnost Amaranthus retroflexus. A. powellii a A. hybridus. Canadian Journal of Plant Science 64: 715-724.

      --& E. L. McWilliams. 1980. Biologie kanadských plevelů. 44. Amaranthus retroflexus L, Amaranthus powelli S. Wats a Amaranthus hybridus L. Canadian Journal of Plant Science 60: 1215-1234.

      --& A. G. Thomas. 1986. Reakce klíčení na teplotu u atrazin-rezistentních a citlivých biotypů dvou druhů prasečí (Amaranthus). Weed Science 34: 865-870.

      Webb, D.M., C.W. Smith & J. Schulz-Schaeffer. 1987. Vzcházení sazenic amarantu ovlivněné hloubkou výsevu a teplotou na termogradientní desce. Agronomický časopis 79: 23-26.

      Webster, T. M. 2009. Průzkum plevelů – Jižní státy. Proceedings of the Southern Weed Science Society 62: 509-524.

      --& L. M. Sosnoskie. 2010. Ztráta účinnosti glyfosátu: Měnící se spektrum plevelů v bavlníku v Georgii. Weed Science 58: 73-79.

      Wetzel, D. K., M. J. Horák & D. Z. Skinner. 1999a. Použití molekulárních markerů založených na PCR k identifikaci plevelných druhů Amaranthus. Weed Science 47: 518-523.

      --, --, --& P. A. Kulakow. 1999b. Přenos znaků odolnosti vůči herbicidům z Amaranthus palmeri na Amaranthus rudis. Weed Science 47: 538-543.

      Whitehead, W. F. & B. P. Singh. 1993. Hustota populace a vliv pH půdy na produkci rostlinného amarantu. In: Janick, J. a Simon, J. E. (eds.), Nové plodiny. Wiley, New York: 562-564.

      Wiersema, J. H. & B. Leon. 1999. Světové hospodářské závody CRC Press: Boca Raton, s. 32-34.

      Wiese, A. M. & L. K. Binning. 1987. Výpočet prahové teploty vývoje pro plevele. Weed Science 35: 177-179.

      Wiese, A.E. & R.G. Davis. 1967. Vzcházení plevele ze dvou půd při různých vlhkostech, teplotách a hloubkách. Weeds 15: 118-121.

      Williams, J. T. & D. Brenner. 1995. Amarant zrnitý (druh Amaranthus). Obiloviny a pseudocereálie.

      Williams, R., L. Peal & P. ​​Bartholomew. 2005. Hydratace/dehydratace semen pomocí alelochemie (kumarin) mění klíčení a růst semenáčků. Allelopathy Journal 15: 183-196.

      Wills, R. B. H., A. W. K. Wong, F. M. Scriven & H. Greenfield. 1984. Složení živin čínské zeleniny. Journal of Agricultural and Food Chemistry 32: 413-416.

      Wise, A. M., T. L. Grey, E. P. Prostko, W. K. Vencill & T. M. Webster. 2009. Stanovení geografické úrovně distribuce rezistence k acetolaktátsyntáze u přírůstků amarantu palmového (Amaranthus palmeri) v Gruzii. Weed Technology 23: 214-220.

      Woolley, J. T. & E. Stoller. 1978. Pronikání světla a světlem indukované klíčení semen v půdě. Plant Physiology 61: 597-600.

      Wright S. W., H. D. Coble, C. D. Raper & T. W. Rufty. 1999. Srovnávací odezvy sóji (Glycine max), srpovitého lusku (Senna obtusifolia) a amarantu palmového (Amaranthus palmeri) na kořenovou zónu a teplotu vzduchu. Weed Science 47: 167-174.

      Yan, X., L. Zhenyu, W. P. Gregg & L. Dianmo. 2001. Invazní druhy v Číně-přehled. Biodiverzita a ochrana 10: 1317-1341.

      York, A. C., J. R. Whitaker, A. S. Culpepper & C. L. Main. 2007. Palmer amarant odolný vůči glyfosátu na jihovýchodě Spojených států. Proceedings of the Southern Weed Science Society 60: 225.

      Rezwana Assad (1) * Zafar A. Reshi (1) * Snober Jan (1) * Irfan Rashid (1,2)

      (1) Katedra botaniky, Univerzita Kašmír, Šrínagar. J&K 190 006, Indie


      Podívejte se na video: Taxonomic keys, couplet, lead, Manual, Monograph, Flora, Fauna, Catalogue (Prosinec 2022).